Multiple sequence alignment - TraesCS2D01G566100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G566100 chr2D 100.000 3595 0 0 1 3595 635507645 635504051 0 6639
1 TraesCS2D01G566100 chr2D 99.138 3595 31 0 1 3595 635523576 635519982 0 6468
2 TraesCS2D01G566100 chr2D 99.055 3596 30 2 1 3595 635540218 635536626 0 6449
3 TraesCS2D01G566100 chr2D 98.971 3597 35 2 1 3595 635576945 635573349 0 6436
4 TraesCS2D01G566100 chr2D 98.721 3597 43 2 1 3595 635499669 635496074 0 6384
5 TraesCS2D01G566100 chr2D 98.693 3595 42 3 1 3595 635532244 635528655 0 6373
6 TraesCS2D01G566100 chr2D 98.498 3595 51 3 1 3595 635482325 635478734 0 6336
7 TraesCS2D01G566100 chrUn 98.860 3596 39 2 1 3595 31833996 31837590 0 6412
8 TraesCS2D01G566100 chrUn 98.860 3596 39 2 1 3595 31848530 31852124 0 6412
9 TraesCS2D01G566100 chrUn 98.778 2536 30 1 1 2535 31842678 31845213 0 4510
10 TraesCS2D01G566100 chrUn 98.873 1331 15 0 2265 3595 394087153 394088483 0 2375


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G566100 chr2D 635504051 635507645 3594 True 6639 6639 100.000 1 3595 1 chr2D.!!$R3 3594
1 TraesCS2D01G566100 chr2D 635519982 635523576 3594 True 6468 6468 99.138 1 3595 1 chr2D.!!$R4 3594
2 TraesCS2D01G566100 chr2D 635536626 635540218 3592 True 6449 6449 99.055 1 3595 1 chr2D.!!$R6 3594
3 TraesCS2D01G566100 chr2D 635573349 635576945 3596 True 6436 6436 98.971 1 3595 1 chr2D.!!$R7 3594
4 TraesCS2D01G566100 chr2D 635496074 635499669 3595 True 6384 6384 98.721 1 3595 1 chr2D.!!$R2 3594
5 TraesCS2D01G566100 chr2D 635528655 635532244 3589 True 6373 6373 98.693 1 3595 1 chr2D.!!$R5 3594
6 TraesCS2D01G566100 chr2D 635478734 635482325 3591 True 6336 6336 98.498 1 3595 1 chr2D.!!$R1 3594
7 TraesCS2D01G566100 chrUn 31833996 31837590 3594 False 6412 6412 98.860 1 3595 1 chrUn.!!$F1 3594
8 TraesCS2D01G566100 chrUn 31842678 31852124 9446 False 5461 6412 98.819 1 3595 2 chrUn.!!$F3 3594
9 TraesCS2D01G566100 chrUn 394087153 394088483 1330 False 2375 2375 98.873 2265 3595 1 chrUn.!!$F2 1330

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
920 6776 2.407846 ATACGCGAGCCTGTCATCCG 62.408 60.000 15.93 0.0 0.0 4.18 F
2360 8216 8.162245 GTGTTTGAAAATGTCTGAGTTTGTTTC 58.838 33.333 0.00 0.0 0.0 2.78 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1845 7701 5.913137 AACATGTCACACCTCTTTTGAAA 57.087 34.783 0.0 0.0 0.0 2.69 R
3328 9185 9.239551 TGTAGTACATATCAGGCTTCGTATAAT 57.760 33.333 0.0 0.0 0.0 1.28 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
90 5945 8.706035 CAGGATTGACAATTTTGATTTTCAGTC 58.294 33.333 1.39 3.59 0.00 3.51
132 5987 6.572167 TTAACAAAATACGTGGGGGTTTAG 57.428 37.500 0.00 0.00 0.00 1.85
659 6515 3.058914 ACGATGCGAAAGGAAAGAAACAG 60.059 43.478 0.00 0.00 32.68 3.16
920 6776 2.407846 ATACGCGAGCCTGTCATCCG 62.408 60.000 15.93 0.00 0.00 4.18
2360 8216 8.162245 GTGTTTGAAAATGTCTGAGTTTGTTTC 58.838 33.333 0.00 0.00 0.00 2.78
3328 9185 5.984725 ACCATGGTGTCAATACTTCGATTA 58.015 37.500 18.99 0.00 0.00 1.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
132 5987 2.393271 CACCAGAGTGTGAATCCTCC 57.607 55.000 0.0 0.0 39.3 4.30
920 6776 3.002246 TGTGTGTTTGCTCGATGAACTTC 59.998 43.478 0.0 0.0 0.0 3.01
1845 7701 5.913137 AACATGTCACACCTCTTTTGAAA 57.087 34.783 0.0 0.0 0.0 2.69
3328 9185 9.239551 TGTAGTACATATCAGGCTTCGTATAAT 57.760 33.333 0.0 0.0 0.0 1.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.