Multiple sequence alignment - TraesCS2D01G564600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G564600 chr2D 100.000 2528 0 0 1 2528 635037259 635039786 0 4669
1 TraesCS2D01G564600 chr7B 98.775 2531 27 3 1 2528 743066304 743068833 0 4499
2 TraesCS2D01G564600 chr2A 98.696 2530 27 3 1 2526 735172798 735175325 0 4484
3 TraesCS2D01G564600 chr7A 98.655 2528 31 1 1 2528 120828849 120826325 0 4477
4 TraesCS2D01G564600 chr7A 98.538 2530 33 4 1 2528 671960569 671958042 0 4464
5 TraesCS2D01G564600 chr3D 98.616 2529 33 2 1 2528 202611945 202614472 0 4475
6 TraesCS2D01G564600 chr5A 98.579 2533 30 4 1 2528 16623276 16620745 0 4473
7 TraesCS2D01G564600 chr3B 98.616 2528 32 2 1 2528 201635804 201633280 0 4471
8 TraesCS2D01G564600 chr5B 98.458 2530 34 2 1 2528 713046212 713043686 0 4451


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G564600 chr2D 635037259 635039786 2527 False 4669 4669 100.000 1 2528 1 chr2D.!!$F1 2527
1 TraesCS2D01G564600 chr7B 743066304 743068833 2529 False 4499 4499 98.775 1 2528 1 chr7B.!!$F1 2527
2 TraesCS2D01G564600 chr2A 735172798 735175325 2527 False 4484 4484 98.696 1 2526 1 chr2A.!!$F1 2525
3 TraesCS2D01G564600 chr7A 120826325 120828849 2524 True 4477 4477 98.655 1 2528 1 chr7A.!!$R1 2527
4 TraesCS2D01G564600 chr7A 671958042 671960569 2527 True 4464 4464 98.538 1 2528 1 chr7A.!!$R2 2527
5 TraesCS2D01G564600 chr3D 202611945 202614472 2527 False 4475 4475 98.616 1 2528 1 chr3D.!!$F1 2527
6 TraesCS2D01G564600 chr5A 16620745 16623276 2531 True 4473 4473 98.579 1 2528 1 chr5A.!!$R1 2527
7 TraesCS2D01G564600 chr3B 201633280 201635804 2524 True 4471 4471 98.616 1 2528 1 chr3B.!!$R1 2527
8 TraesCS2D01G564600 chr5B 713043686 713046212 2526 True 4451 4451 98.458 1 2528 1 chr5B.!!$R1 2527

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
713 715 1.526464 GACAAATTGCGTTTTGCCAGG 59.474 47.619 10.19 0.0 45.6 4.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1590 1597 1.153823 CGCACAAGACTACCCCTCG 60.154 63.158 0.0 0.0 0.0 4.63 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
112 113 2.811431 CGGCAGTTTGGTTTATCTGACA 59.189 45.455 0.00 0.00 35.89 3.58
488 490 4.944317 GGTTTCATTTGAAAAACCCCAACA 59.056 37.500 7.28 0.00 45.67 3.33
713 715 1.526464 GACAAATTGCGTTTTGCCAGG 59.474 47.619 10.19 0.00 45.60 4.45
738 740 5.425577 GATTCTTTAGAAAGATTCCCGGC 57.574 43.478 5.57 0.00 43.92 6.13
785 787 9.726438 AGTTAGAATCTAAATAAAGGCGCATAT 57.274 29.630 10.83 1.28 0.00 1.78
1804 1812 1.609501 CCTCGTCAAGTCAGGGGGA 60.610 63.158 0.00 0.00 0.00 4.81
1932 1941 5.607171 AGGGATAATCGTCCAGGTCTTATTT 59.393 40.000 0.00 0.00 40.17 1.40
2033 2043 6.870971 AGGATAAGTTGCTAAAACAAACGA 57.129 33.333 0.00 0.00 0.00 3.85
2110 2121 0.486879 AGACATTTCTTTGGCCCCCA 59.513 50.000 0.00 0.00 0.00 4.96
2396 2407 1.749063 TGATGCGGAAGTCTCACGTAT 59.251 47.619 0.00 0.56 35.72 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
69 70 1.810755 CCTACTGTCTGTACTGCGTCA 59.189 52.381 0.00 0.0 0.00 4.35
488 490 3.129287 GGATTTGACGCAAGATGAATGGT 59.871 43.478 0.00 0.0 43.62 3.55
1106 1113 3.871006 GCACAGACCAATCAATCGTATCA 59.129 43.478 0.00 0.0 0.00 2.15
1590 1597 1.153823 CGCACAAGACTACCCCTCG 60.154 63.158 0.00 0.0 0.00 4.63
1804 1812 2.606961 CGCGCAAGTGTGTCCACAT 61.607 57.895 8.75 0.0 44.39 3.21
2033 2043 2.444140 CGGGTCGATCCTCCCCTT 60.444 66.667 14.05 0.0 40.54 3.95
2110 2121 1.688197 CCTGCCCGCATTTATTTGGAT 59.312 47.619 0.00 0.0 0.00 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.