Multiple sequence alignment - TraesCS2D01G564500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G564500 chr2D 100.000 3196 0 0 1 3196 635019107 635022302 0.000000e+00 5903
1 TraesCS2D01G564500 chr2D 98.742 159 2 0 2337 2495 425290996 425291154 1.880000e-72 283
2 TraesCS2D01G564500 chr7D 99.218 3197 23 2 1 3196 381882008 381878813 0.000000e+00 5764
3 TraesCS2D01G564500 chr7D 98.499 3197 40 4 1 3196 203530170 203526981 0.000000e+00 5631
4 TraesCS2D01G564500 chr7D 95.936 2485 94 5 1 2483 307185386 307182907 0.000000e+00 4023
5 TraesCS2D01G564500 chr7D 97.361 720 19 0 2477 3196 307179567 307178848 0.000000e+00 1225
6 TraesCS2D01G564500 chr7D 98.253 229 4 0 2114 2342 18404107 18404335 4.970000e-108 401
7 TraesCS2D01G564500 chr7D 98.824 85 1 0 2307 2391 404384564 404384480 5.520000e-33 152
8 TraesCS2D01G564500 chr4D 98.718 3197 38 2 1 3196 123731196 123728002 0.000000e+00 5674
9 TraesCS2D01G564500 chr4D 98.092 3197 55 5 1 3196 134969078 134972269 0.000000e+00 5561
10 TraesCS2D01G564500 chr3D 97.529 3197 61 5 1 3196 501892041 501895220 0.000000e+00 5450
11 TraesCS2D01G564500 chrUn 98.859 2278 24 2 1 2276 223715548 223717825 0.000000e+00 4061
12 TraesCS2D01G564500 chrUn 99.148 1408 12 0 1764 3171 402971007 402972414 0.000000e+00 2534
13 TraesCS2D01G564500 chrUn 99.841 629 1 0 2568 3196 381709206 381708578 0.000000e+00 1157
14 TraesCS2D01G564500 chr2A 98.766 2188 25 2 1 2186 755521015 755518828 0.000000e+00 3890
15 TraesCS2D01G564500 chr5B 98.537 2187 30 2 1 2186 127798271 127796086 0.000000e+00 3860
16 TraesCS2D01G564500 chr6D 98.464 781 11 1 2417 3196 425976144 425976924 0.000000e+00 1375
17 TraesCS2D01G564500 chr6B 96.809 188 6 0 2414 2601 197526834 197526647 6.660000e-82 315


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G564500 chr2D 635019107 635022302 3195 False 5903 5903 100.0000 1 3196 1 chr2D.!!$F2 3195
1 TraesCS2D01G564500 chr7D 381878813 381882008 3195 True 5764 5764 99.2180 1 3196 1 chr7D.!!$R2 3195
2 TraesCS2D01G564500 chr7D 203526981 203530170 3189 True 5631 5631 98.4990 1 3196 1 chr7D.!!$R1 3195
3 TraesCS2D01G564500 chr7D 307178848 307185386 6538 True 2624 4023 96.6485 1 3196 2 chr7D.!!$R4 3195
4 TraesCS2D01G564500 chr4D 123728002 123731196 3194 True 5674 5674 98.7180 1 3196 1 chr4D.!!$R1 3195
5 TraesCS2D01G564500 chr4D 134969078 134972269 3191 False 5561 5561 98.0920 1 3196 1 chr4D.!!$F1 3195
6 TraesCS2D01G564500 chr3D 501892041 501895220 3179 False 5450 5450 97.5290 1 3196 1 chr3D.!!$F1 3195
7 TraesCS2D01G564500 chrUn 223715548 223717825 2277 False 4061 4061 98.8590 1 2276 1 chrUn.!!$F1 2275
8 TraesCS2D01G564500 chrUn 402971007 402972414 1407 False 2534 2534 99.1480 1764 3171 1 chrUn.!!$F2 1407
9 TraesCS2D01G564500 chrUn 381708578 381709206 628 True 1157 1157 99.8410 2568 3196 1 chrUn.!!$R1 628
10 TraesCS2D01G564500 chr2A 755518828 755521015 2187 True 3890 3890 98.7660 1 2186 1 chr2A.!!$R1 2185
11 TraesCS2D01G564500 chr5B 127796086 127798271 2185 True 3860 3860 98.5370 1 2186 1 chr5B.!!$R1 2185
12 TraesCS2D01G564500 chr6D 425976144 425976924 780 False 1375 1375 98.4640 2417 3196 1 chr6D.!!$F1 779

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
503 509 0.035820 TGGTAGAACCCACGCCAATC 60.036 55.000 0.00 0.0 37.5 2.67 F
690 696 1.447314 GGCTAGGTAGTTTGCGCGT 60.447 57.895 8.43 0.0 0.0 6.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1818 1828 3.857157 ATACCATTCCGGCACAATACT 57.143 42.857 0.00 0.0 39.03 2.12 R
2566 5925 1.134753 ACGACATATGCGACCGGTTTA 59.865 47.619 21.03 0.0 0.00 2.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
374 380 6.276832 TCTATCAGTTAGTAACAAAGCCGT 57.723 37.500 15.28 0.0 0.00 5.68
503 509 0.035820 TGGTAGAACCCACGCCAATC 60.036 55.000 0.00 0.0 37.50 2.67
690 696 1.447314 GGCTAGGTAGTTTGCGCGT 60.447 57.895 8.43 0.0 0.00 6.01
1360 1370 4.081309 CAGTCCTAGGGAATTTGTTCGGTA 60.081 45.833 9.46 0.0 31.38 4.02
1380 1390 5.278315 CGGTATCTCGGAGTTGTCATATTCA 60.278 44.000 4.69 0.0 0.00 2.57
1819 1829 4.256180 GATGCCCACCCCGCCTAG 62.256 72.222 0.00 0.0 0.00 3.02
2251 2263 7.247728 TGGCACAATGAATTTACGAGTTATTC 58.752 34.615 0.00 0.0 31.92 1.75
2566 5925 5.221925 TGGGATGACACTCTTCTTAAAAGCT 60.222 40.000 0.00 0.0 0.00 3.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
331 337 7.884354 TGATAGAAACCCCTTAATACAACGTTT 59.116 33.333 0.00 0.00 0.00 3.60
503 509 4.819088 TGGACGAGAGAGAGTCAATATGAG 59.181 45.833 0.00 0.00 39.01 2.90
690 696 5.833131 ACCTTTCATGAAGAAGTTTTGCCTA 59.167 36.000 8.41 0.00 37.57 3.93
1253 1263 3.623703 TGCCCCATTAGCATGCATATAG 58.376 45.455 21.98 5.53 34.69 1.31
1473 1483 5.374753 TGGTATCTCCTACTACTGGTATGGT 59.625 44.000 0.00 0.00 37.07 3.55
1818 1828 3.857157 ATACCATTCCGGCACAATACT 57.143 42.857 0.00 0.00 39.03 2.12
1819 1829 4.261447 GGAAATACCATTCCGGCACAATAC 60.261 45.833 0.00 0.00 39.54 1.89
2009 2021 6.239064 CGATCCAACCTAGTAGTAAGCAATCT 60.239 42.308 0.00 0.00 0.00 2.40
2215 2227 5.725325 TTCATTGTGCCAGAATTGATCAA 57.275 34.783 11.26 11.26 0.00 2.57
2566 5925 1.134753 ACGACATATGCGACCGGTTTA 59.865 47.619 21.03 0.00 0.00 2.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.