Multiple sequence alignment - TraesCS2D01G558300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G558300 chr2D 100.000 3010 0 0 1 3010 631305886 631308895 0.000000e+00 5559.0
1 TraesCS2D01G558300 chr2D 86.772 756 82 10 1234 1978 647975078 647974330 0.000000e+00 826.0
2 TraesCS2D01G558300 chr2D 79.895 761 101 30 1236 1978 645204172 645203446 7.440000e-141 510.0
3 TraesCS2D01G558300 chr2B 95.039 1915 52 13 882 2773 774838877 774840771 0.000000e+00 2970.0
4 TraesCS2D01G558300 chr2B 97.382 802 21 0 1370 2171 744318420 744317619 0.000000e+00 1365.0
5 TraesCS2D01G558300 chr2B 95.210 856 26 11 2165 3010 744312063 744311213 0.000000e+00 1339.0
6 TraesCS2D01G558300 chr2B 95.866 508 10 5 867 1371 744319142 744318643 0.000000e+00 811.0
7 TraesCS2D01G558300 chr2B 85.196 716 104 2 3 717 800301767 800302481 0.000000e+00 734.0
8 TraesCS2D01G558300 chr2B 77.997 759 105 33 1237 1971 627836625 627837345 1.290000e-113 420.0
9 TraesCS2D01G558300 chr2B 98.693 153 2 0 719 871 744320108 744319956 3.820000e-69 272.0
10 TraesCS2D01G558300 chr2B 98.582 141 2 0 719 859 774819990 774820130 1.790000e-62 250.0
11 TraesCS2D01G558300 chr2B 98.374 123 2 0 719 841 774836847 774836969 1.820000e-52 217.0
12 TraesCS2D01G558300 chr2B 99.091 110 1 0 719 828 774811676 774811785 6.580000e-47 198.0
13 TraesCS2D01G558300 chr2B 93.069 101 6 1 2069 2168 371564703 371564803 2.420000e-31 147.0
14 TraesCS2D01G558300 chr2B 100.000 79 0 0 781 859 774811774 774811852 2.420000e-31 147.0
15 TraesCS2D01G558300 chr1D 95.301 915 26 8 1124 2026 432550851 432549942 0.000000e+00 1435.0
16 TraesCS2D01G558300 chr1D 97.610 251 5 1 890 1139 432551121 432550871 2.140000e-116 429.0
17 TraesCS2D01G558300 chr1D 97.279 147 2 2 719 865 432551253 432551109 6.440000e-62 248.0
18 TraesCS2D01G558300 chr1D 100.000 58 0 0 2013 2070 432548398 432548341 1.140000e-19 108.0
19 TraesCS2D01G558300 chr7D 97.629 717 17 0 1 717 485843079 485842363 0.000000e+00 1230.0
20 TraesCS2D01G558300 chr5B 94.561 717 38 1 1 717 530643387 530642672 0.000000e+00 1107.0
21 TraesCS2D01G558300 chr5B 100.000 30 0 0 2547 2576 635737170 635737141 4.190000e-04 56.5
22 TraesCS2D01G558300 chr2A 90.251 718 69 1 1 717 173409139 173408422 0.000000e+00 937.0
23 TraesCS2D01G558300 chr2A 88.756 587 47 11 2427 3010 59243671 59244241 0.000000e+00 701.0
24 TraesCS2D01G558300 chr7A 88.424 717 83 0 1 717 677729003 677729719 0.000000e+00 865.0
25 TraesCS2D01G558300 chr7A 89.932 586 46 5 2427 3010 94922463 94923037 0.000000e+00 743.0
26 TraesCS2D01G558300 chrUn 83.925 958 93 27 1056 1975 31352551 31353485 0.000000e+00 859.0
27 TraesCS2D01G558300 chrUn 83.569 919 90 21 1078 1978 104053113 104052238 0.000000e+00 804.0
28 TraesCS2D01G558300 chrUn 82.443 917 110 19 1075 1978 76956985 76957863 0.000000e+00 754.0
29 TraesCS2D01G558300 chrUn 85.196 716 104 2 3 717 300628181 300628895 0.000000e+00 734.0
30 TraesCS2D01G558300 chrUn 75.217 577 137 6 1 574 30495766 30495193 4.950000e-68 268.0
31 TraesCS2D01G558300 chrUn 88.679 53 6 0 1234 1286 478983911 478983859 6.970000e-07 65.8
32 TraesCS2D01G558300 chr1B 87.187 718 89 3 1 717 640625129 640625844 0.000000e+00 813.0
33 TraesCS2D01G558300 chr5D 90.940 585 45 5 2428 3010 388861337 388861915 0.000000e+00 780.0
34 TraesCS2D01G558300 chr5D 88.180 423 35 5 2590 3010 482796825 482797234 9.700000e-135 490.0
35 TraesCS2D01G558300 chr5D 88.889 315 24 9 2060 2366 388860944 388861255 7.880000e-101 377.0
36 TraesCS2D01G558300 chr5D 89.714 175 17 1 2427 2601 482796637 482796810 3.910000e-54 222.0
37 TraesCS2D01G558300 chr6A 84.987 746 76 12 1234 1978 31587765 31587055 0.000000e+00 725.0
38 TraesCS2D01G558300 chr6A 84.584 746 80 12 1234 1978 31635794 31636505 0.000000e+00 708.0
39 TraesCS2D01G558300 chr5A 87.748 604 74 0 1 604 671418000 671417397 0.000000e+00 706.0
40 TraesCS2D01G558300 chr6B 86.024 508 54 9 2427 2924 174570607 174571107 2.050000e-146 529.0
41 TraesCS2D01G558300 chr6B 83.136 338 30 16 2091 2421 174570240 174570557 1.770000e-72 283.0
42 TraesCS2D01G558300 chr6B 90.099 101 9 1 2069 2168 162605368 162605268 2.440000e-26 130.0
43 TraesCS2D01G558300 chr4B 91.892 111 6 3 2060 2168 104815555 104815664 5.200000e-33 152.0
44 TraesCS2D01G558300 chr7B 93.878 98 6 0 2071 2168 687432048 687432145 6.720000e-32 148.0
45 TraesCS2D01G558300 chr3B 92.391 92 7 0 2071 2162 81302670 81302761 6.770000e-27 132.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G558300 chr2D 631305886 631308895 3009 False 5559.0 5559 100.000000 1 3010 1 chr2D.!!$F1 3009
1 TraesCS2D01G558300 chr2D 647974330 647975078 748 True 826.0 826 86.772000 1234 1978 1 chr2D.!!$R2 744
2 TraesCS2D01G558300 chr2D 645203446 645204172 726 True 510.0 510 79.895000 1236 1978 1 chr2D.!!$R1 742
3 TraesCS2D01G558300 chr2B 774836847 774840771 3924 False 1593.5 2970 96.706500 719 2773 2 chr2B.!!$F6 2054
4 TraesCS2D01G558300 chr2B 744311213 744312063 850 True 1339.0 1339 95.210000 2165 3010 1 chr2B.!!$R1 845
5 TraesCS2D01G558300 chr2B 744317619 744320108 2489 True 816.0 1365 97.313667 719 2171 3 chr2B.!!$R2 1452
6 TraesCS2D01G558300 chr2B 800301767 800302481 714 False 734.0 734 85.196000 3 717 1 chr2B.!!$F4 714
7 TraesCS2D01G558300 chr2B 627836625 627837345 720 False 420.0 420 77.997000 1237 1971 1 chr2B.!!$F2 734
8 TraesCS2D01G558300 chr1D 432548341 432551253 2912 True 555.0 1435 97.547500 719 2070 4 chr1D.!!$R1 1351
9 TraesCS2D01G558300 chr7D 485842363 485843079 716 True 1230.0 1230 97.629000 1 717 1 chr7D.!!$R1 716
10 TraesCS2D01G558300 chr5B 530642672 530643387 715 True 1107.0 1107 94.561000 1 717 1 chr5B.!!$R1 716
11 TraesCS2D01G558300 chr2A 173408422 173409139 717 True 937.0 937 90.251000 1 717 1 chr2A.!!$R1 716
12 TraesCS2D01G558300 chr2A 59243671 59244241 570 False 701.0 701 88.756000 2427 3010 1 chr2A.!!$F1 583
13 TraesCS2D01G558300 chr7A 677729003 677729719 716 False 865.0 865 88.424000 1 717 1 chr7A.!!$F2 716
14 TraesCS2D01G558300 chr7A 94922463 94923037 574 False 743.0 743 89.932000 2427 3010 1 chr7A.!!$F1 583
15 TraesCS2D01G558300 chrUn 31352551 31353485 934 False 859.0 859 83.925000 1056 1975 1 chrUn.!!$F1 919
16 TraesCS2D01G558300 chrUn 104052238 104053113 875 True 804.0 804 83.569000 1078 1978 1 chrUn.!!$R2 900
17 TraesCS2D01G558300 chrUn 76956985 76957863 878 False 754.0 754 82.443000 1075 1978 1 chrUn.!!$F2 903
18 TraesCS2D01G558300 chrUn 300628181 300628895 714 False 734.0 734 85.196000 3 717 1 chrUn.!!$F3 714
19 TraesCS2D01G558300 chrUn 30495193 30495766 573 True 268.0 268 75.217000 1 574 1 chrUn.!!$R1 573
20 TraesCS2D01G558300 chr1B 640625129 640625844 715 False 813.0 813 87.187000 1 717 1 chr1B.!!$F1 716
21 TraesCS2D01G558300 chr5D 388860944 388861915 971 False 578.5 780 89.914500 2060 3010 2 chr5D.!!$F1 950
22 TraesCS2D01G558300 chr5D 482796637 482797234 597 False 356.0 490 88.947000 2427 3010 2 chr5D.!!$F2 583
23 TraesCS2D01G558300 chr6A 31587055 31587765 710 True 725.0 725 84.987000 1234 1978 1 chr6A.!!$R1 744
24 TraesCS2D01G558300 chr6A 31635794 31636505 711 False 708.0 708 84.584000 1234 1978 1 chr6A.!!$F1 744
25 TraesCS2D01G558300 chr5A 671417397 671418000 603 True 706.0 706 87.748000 1 604 1 chr5A.!!$R1 603
26 TraesCS2D01G558300 chr6B 174570240 174571107 867 False 406.0 529 84.580000 2091 2924 2 chr6B.!!$F1 833

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
87 88 1.136329 ACATCAACCCAGGCTGGAGT 61.136 55.000 34.84 25.62 40.96 3.85 F
599 601 4.339872 TGCTTAACTTCCTCGTTGGTAA 57.660 40.909 0.00 0.00 37.07 2.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1261 3199 0.320771 CGTCCTGTCTGTCCCCAAAG 60.321 60.0 0.0 0.0 0.00 2.77 R
2178 5973 0.528684 GACACTAGCGACATGAGCCC 60.529 60.0 0.0 0.0 34.64 5.19 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
87 88 1.136329 ACATCAACCCAGGCTGGAGT 61.136 55.000 34.84 25.62 40.96 3.85
224 226 5.981174 TCATGAAGTGCAGACATTCATAGA 58.019 37.500 13.15 11.03 40.71 1.98
489 491 6.370718 CGCAGTACAACCTTAGTAATTTCCTT 59.629 38.462 0.00 0.00 0.00 3.36
492 494 7.390718 CAGTACAACCTTAGTAATTTCCTTGCT 59.609 37.037 0.00 0.00 33.95 3.91
599 601 4.339872 TGCTTAACTTCCTCGTTGGTAA 57.660 40.909 0.00 0.00 37.07 2.85
717 719 4.393062 CAGTGCCTCATAAAACTCACGAAT 59.607 41.667 0.00 0.00 0.00 3.34
721 723 7.336931 AGTGCCTCATAAAACTCACGAATAAAT 59.663 33.333 0.00 0.00 0.00 1.40
1228 3166 5.887598 TCAAACGAAAGATCCATCCATCATT 59.112 36.000 0.00 0.00 0.00 2.57
1229 3167 6.377996 TCAAACGAAAGATCCATCCATCATTT 59.622 34.615 0.00 0.00 0.00 2.32
1230 3168 7.555914 TCAAACGAAAGATCCATCCATCATTTA 59.444 33.333 0.00 0.00 0.00 1.40
1231 3169 7.880160 AACGAAAGATCCATCCATCATTTAA 57.120 32.000 0.00 0.00 0.00 1.52
1261 3199 9.984190 TTTATTTATTTGGTGTACCCTTGTTTC 57.016 29.630 0.00 0.00 34.29 2.78
1622 3828 9.935682 CTTTTTCGCTGAGCTATATTTTGATAA 57.064 29.630 1.78 0.00 0.00 1.75
2178 5973 9.781834 TGTACAAAATGTTTTTGTTGTCTCTAG 57.218 29.630 19.81 0.00 42.10 2.43
2184 5979 4.134563 GTTTTTGTTGTCTCTAGGGCTCA 58.865 43.478 0.00 0.00 0.00 4.26
2212 6008 0.673985 GTGTCCTTTGGGGCTGTTTC 59.326 55.000 0.00 0.00 38.23 2.78
2229 6025 1.514003 TTCTTTTATCGCGCACACCA 58.486 45.000 8.75 0.00 0.00 4.17
2349 6155 4.570369 CACGTTATATGTGCTTGTGATCCA 59.430 41.667 0.00 0.00 0.00 3.41
2357 6163 4.370049 TGTGCTTGTGATCCATTGTTTTG 58.630 39.130 0.00 0.00 0.00 2.44
2358 6164 4.141981 TGTGCTTGTGATCCATTGTTTTGT 60.142 37.500 0.00 0.00 0.00 2.83
2360 6166 5.049167 TGCTTGTGATCCATTGTTTTGTTC 58.951 37.500 0.00 0.00 0.00 3.18
2465 6323 9.945904 TTAAATTCTTTACTTTTTGGTGGTGTT 57.054 25.926 0.00 0.00 0.00 3.32
2498 6356 0.995803 TCATCAAATTCCCCGGACCA 59.004 50.000 0.73 0.00 0.00 4.02
2576 6434 0.927537 CACTTTCGACACGCAACTCA 59.072 50.000 0.00 0.00 0.00 3.41
2718 6608 2.219216 CGAACACCGACACGTAATTTGT 59.781 45.455 0.00 0.00 41.76 2.83
2778 6668 1.287815 CCGACCTAGTTGCGACACA 59.712 57.895 6.90 0.00 0.00 3.72
2844 6735 7.456269 TCCACTTATTTGTTTGGAACCCAATAT 59.544 33.333 0.00 0.00 43.55 1.28
2897 6790 7.581213 TTTTATGCTCTCCTTTCAGTTTTCA 57.419 32.000 0.00 0.00 0.00 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
87 88 6.869315 TGATCATGTTGAAACTCGGTTTTA 57.131 33.333 0.00 0.00 35.77 1.52
224 226 8.043113 ACTTATCACTGACAACATCATATGTGT 58.957 33.333 1.90 4.04 44.07 3.72
489 491 1.694150 GGCACTGGGATCTATGTAGCA 59.306 52.381 0.00 0.00 0.00 3.49
492 494 3.117131 TCAGAGGCACTGGGATCTATGTA 60.117 47.826 12.06 0.00 45.76 2.29
599 601 4.164843 ACGATATGTTATGTGCCCCTTT 57.835 40.909 0.00 0.00 0.00 3.11
717 719 9.997482 GAAAGCCTACGTTCATTTATTCATTTA 57.003 29.630 0.00 0.00 34.77 1.40
721 723 7.681939 AAGAAAGCCTACGTTCATTTATTCA 57.318 32.000 0.00 0.00 36.82 2.57
1135 3013 7.675062 AGAATAAGAATAGATCCGATGCAAGT 58.325 34.615 0.00 0.00 0.00 3.16
1231 3169 9.936759 CAAGGGTACACCAAATAAATAAACAAT 57.063 29.630 0.00 0.00 43.89 2.71
1261 3199 0.320771 CGTCCTGTCTGTCCCCAAAG 60.321 60.000 0.00 0.00 0.00 2.77
1622 3828 1.471684 CGGCTAGTTCGAGGTACTGTT 59.528 52.381 0.00 0.00 41.55 3.16
2104 5893 6.545666 TGGTGAACAACTTAGATGTGACATTT 59.454 34.615 0.00 0.00 0.00 2.32
2168 5961 2.480416 CGACATGAGCCCTAGAGACAAC 60.480 54.545 0.00 0.00 0.00 3.32
2178 5973 0.528684 GACACTAGCGACATGAGCCC 60.529 60.000 0.00 0.00 34.64 5.19
2184 5979 1.066143 CCCAAAGGACACTAGCGACAT 60.066 52.381 0.00 0.00 33.47 3.06
2212 6008 1.463056 TCTTGGTGTGCGCGATAAAAG 59.537 47.619 12.10 5.30 0.00 2.27
2229 6025 1.003233 CGTACAGGAAAAGGGGCTCTT 59.997 52.381 0.00 0.00 37.28 2.85
2451 6309 6.801575 ACATGTAACTAACACCACCAAAAAG 58.198 36.000 0.00 0.00 42.09 2.27
2465 6323 9.778741 GGGAATTTGATGATAGACATGTAACTA 57.221 33.333 0.00 0.00 39.56 2.24
2498 6356 9.594038 CTAATATTGAACGCGCAACTAAATAAT 57.406 29.630 5.73 0.86 0.00 1.28
2576 6434 0.755698 ACAGATACCGGGTCGAGCAT 60.756 55.000 17.59 0.34 0.00 3.79
2663 6553 0.322187 GGTGTATTCGGTTGGGTGCT 60.322 55.000 0.00 0.00 0.00 4.40
2710 6600 6.204495 ACATGCAATTGGGTTGAACAAATTAC 59.796 34.615 7.72 4.31 40.37 1.89
2711 6601 6.294473 ACATGCAATTGGGTTGAACAAATTA 58.706 32.000 7.72 0.00 40.37 1.40
2718 6608 2.323599 TGGACATGCAATTGGGTTGAA 58.676 42.857 7.72 0.00 40.37 2.69
2778 6668 1.198759 ACTACACCCTCGGGCATTGT 61.199 55.000 0.82 1.97 39.32 2.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.