Multiple sequence alignment - TraesCS2D01G557100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G557100 chr2D 100.000 2564 0 0 1 2564 630266208 630268771 0 4735
1 TraesCS2D01G557100 chr2D 98.713 2565 29 3 1 2564 272804677 272802116 0 4551
2 TraesCS2D01G557100 chr2D 98.089 2564 42 3 1 2564 196966758 196964202 0 4457
3 TraesCS2D01G557100 chr3B 98.020 2576 33 5 1 2564 201563800 201561231 0 4458
4 TraesCS2D01G557100 chr7B 98.020 2576 32 6 1 2564 662734495 662737063 0 4457
5 TraesCS2D01G557100 chr3A 98.051 2566 44 3 1 2564 672881449 672878888 0 4457
6 TraesCS2D01G557100 chr5B 97.078 2567 59 10 2 2564 432873713 432876267 0 4311


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G557100 chr2D 630266208 630268771 2563 False 4735 4735 100.000 1 2564 1 chr2D.!!$F1 2563
1 TraesCS2D01G557100 chr2D 272802116 272804677 2561 True 4551 4551 98.713 1 2564 1 chr2D.!!$R2 2563
2 TraesCS2D01G557100 chr2D 196964202 196966758 2556 True 4457 4457 98.089 1 2564 1 chr2D.!!$R1 2563
3 TraesCS2D01G557100 chr3B 201561231 201563800 2569 True 4458 4458 98.020 1 2564 1 chr3B.!!$R1 2563
4 TraesCS2D01G557100 chr7B 662734495 662737063 2568 False 4457 4457 98.020 1 2564 1 chr7B.!!$F1 2563
5 TraesCS2D01G557100 chr3A 672878888 672881449 2561 True 4457 4457 98.051 1 2564 1 chr3A.!!$R1 2563
6 TraesCS2D01G557100 chr5B 432873713 432876267 2554 False 4311 4311 97.078 2 2564 1 chr5B.!!$F1 2562

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
283 284 2.03229 CAGGTATGCGAATGATGCACAG 60.032 50.0 0.0 0.0 46.57 3.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1992 2003 8.250332 TGATAATTTCTACAAATTGCAAGTCCC 58.75 33.333 4.94 0.0 41.47 4.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
283 284 2.032290 CAGGTATGCGAATGATGCACAG 60.032 50.000 0.00 0.0 46.57 3.66
293 294 4.091365 CGAATGATGCACAGTTACTTTCGA 59.909 41.667 5.88 0.0 39.02 3.71
340 341 9.046846 TCTACCTTATGGATGGATCGATAAATT 57.953 33.333 0.00 0.0 37.15 1.82
1388 1392 5.864418 TTAGCCGATCTTAGTATTGGTGT 57.136 39.130 0.00 0.0 33.45 4.16
1908 1919 4.781775 TCCACCAAAAGTTAGTGAAGGA 57.218 40.909 2.96 0.0 33.21 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
283 284 4.107363 ACTCCTCCGATTCGAAAGTAAC 57.893 45.455 7.83 0.0 0.00 2.50
1992 2003 8.250332 TGATAATTTCTACAAATTGCAAGTCCC 58.750 33.333 4.94 0.0 41.47 4.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.