Multiple sequence alignment - TraesCS2D01G557000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G557000 chr2D 100.000 2700 0 0 1 2700 630263989 630261290 0.000000e+00 4987
1 TraesCS2D01G557000 chr2D 96.751 1231 40 0 1470 2700 460656070 460657300 0.000000e+00 2052
2 TraesCS2D01G557000 chr2D 96.669 1231 41 0 1470 2700 116657204 116658434 0.000000e+00 2047
3 TraesCS2D01G557000 chr2D 96.588 1231 42 0 1470 2700 220633436 220634666 0.000000e+00 2041
4 TraesCS2D01G557000 chr3D 98.984 1477 8 3 1 1473 24162290 24160817 0.000000e+00 2638
5 TraesCS2D01G557000 chr3B 98.778 1473 9 5 1 1473 201489841 201488378 0.000000e+00 2612
6 TraesCS2D01G557000 chr3B 98.507 67 1 0 1407 1473 152335093 152335027 4.720000e-23 119
7 TraesCS2D01G557000 chr5D 98.503 1470 12 6 1 1470 6239176 6240635 0.000000e+00 2584
8 TraesCS2D01G557000 chr5D 98.371 1473 12 6 1 1473 503327617 503326157 0.000000e+00 2577
9 TraesCS2D01G557000 chr1A 98.503 1470 10 7 1 1470 554451105 554452562 0.000000e+00 2582
10 TraesCS2D01G557000 chrUn 98.959 1441 6 6 1 1439 30304308 30305741 0.000000e+00 2569
11 TraesCS2D01G557000 chr7B 98.299 1470 13 6 1 1470 662740904 662742361 0.000000e+00 2566
12 TraesCS2D01G557000 chr7B 98.167 1473 14 5 1 1473 397632050 397630591 0.000000e+00 2558
13 TraesCS2D01G557000 chr1D 97.963 1473 18 6 1 1473 254473524 254472064 0.000000e+00 2543
14 TraesCS2D01G557000 chr1D 96.751 1231 40 0 1470 2700 465154105 465155335 0.000000e+00 2052
15 TraesCS2D01G557000 chr1D 96.661 1228 41 0 1473 2700 427668383 427667156 0.000000e+00 2041
16 TraesCS2D01G557000 chr7D 96.832 1231 39 0 1470 2700 15746633 15745403 0.000000e+00 2058
17 TraesCS2D01G557000 chr6D 96.827 1229 39 0 1470 2698 443338497 443337269 0.000000e+00 2054
18 TraesCS2D01G557000 chr6D 96.588 1231 42 0 1470 2700 440691412 440690182 0.000000e+00 2041
19 TraesCS2D01G557000 chr6D 96.588 1231 42 0 1470 2700 460128825 460127595 0.000000e+00 2041


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G557000 chr2D 630261290 630263989 2699 True 4987 4987 100.000 1 2700 1 chr2D.!!$R1 2699
1 TraesCS2D01G557000 chr2D 460656070 460657300 1230 False 2052 2052 96.751 1470 2700 1 chr2D.!!$F3 1230
2 TraesCS2D01G557000 chr2D 116657204 116658434 1230 False 2047 2047 96.669 1470 2700 1 chr2D.!!$F1 1230
3 TraesCS2D01G557000 chr2D 220633436 220634666 1230 False 2041 2041 96.588 1470 2700 1 chr2D.!!$F2 1230
4 TraesCS2D01G557000 chr3D 24160817 24162290 1473 True 2638 2638 98.984 1 1473 1 chr3D.!!$R1 1472
5 TraesCS2D01G557000 chr3B 201488378 201489841 1463 True 2612 2612 98.778 1 1473 1 chr3B.!!$R2 1472
6 TraesCS2D01G557000 chr5D 6239176 6240635 1459 False 2584 2584 98.503 1 1470 1 chr5D.!!$F1 1469
7 TraesCS2D01G557000 chr5D 503326157 503327617 1460 True 2577 2577 98.371 1 1473 1 chr5D.!!$R1 1472
8 TraesCS2D01G557000 chr1A 554451105 554452562 1457 False 2582 2582 98.503 1 1470 1 chr1A.!!$F1 1469
9 TraesCS2D01G557000 chrUn 30304308 30305741 1433 False 2569 2569 98.959 1 1439 1 chrUn.!!$F1 1438
10 TraesCS2D01G557000 chr7B 662740904 662742361 1457 False 2566 2566 98.299 1 1470 1 chr7B.!!$F1 1469
11 TraesCS2D01G557000 chr7B 397630591 397632050 1459 True 2558 2558 98.167 1 1473 1 chr7B.!!$R1 1472
12 TraesCS2D01G557000 chr1D 254472064 254473524 1460 True 2543 2543 97.963 1 1473 1 chr1D.!!$R1 1472
13 TraesCS2D01G557000 chr1D 465154105 465155335 1230 False 2052 2052 96.751 1470 2700 1 chr1D.!!$F1 1230
14 TraesCS2D01G557000 chr1D 427667156 427668383 1227 True 2041 2041 96.661 1473 2700 1 chr1D.!!$R2 1227
15 TraesCS2D01G557000 chr7D 15745403 15746633 1230 True 2058 2058 96.832 1470 2700 1 chr7D.!!$R1 1230
16 TraesCS2D01G557000 chr6D 443337269 443338497 1228 True 2054 2054 96.827 1470 2698 1 chr6D.!!$R2 1228
17 TraesCS2D01G557000 chr6D 440690182 440691412 1230 True 2041 2041 96.588 1470 2700 1 chr6D.!!$R1 1230
18 TraesCS2D01G557000 chr6D 460127595 460128825 1230 True 2041 2041 96.588 1470 2700 1 chr6D.!!$R3 1230

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1619 1637 2.355756 GCACGCACTGTTTGGATGATAT 59.644 45.455 0.0 0.0 0.0 1.63 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2647 2665 1.517238 TCCAGTATGCCCTTATGCCA 58.483 50.0 0.0 0.0 31.97 4.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1619 1637 2.355756 GCACGCACTGTTTGGATGATAT 59.644 45.455 0.00 0.0 0.00 1.63
1620 1638 3.789791 GCACGCACTGTTTGGATGATATG 60.790 47.826 0.00 0.0 0.00 1.78
1780 1798 4.226427 ACTGGTGCTGATGTACATGATT 57.774 40.909 14.43 0.0 0.00 2.57
1908 1926 3.217626 GGATGTGCCCTATTGGAAAGAG 58.782 50.000 0.00 0.0 34.24 2.85
2121 2139 6.695429 GGAAATCTTCTTTGAATTCCTGCTT 58.305 36.000 2.27 0.0 40.83 3.91
2127 2145 8.498054 TCTTCTTTGAATTCCTGCTTAGTATG 57.502 34.615 2.27 0.0 0.00 2.39
2153 2171 0.387202 CCATCTGGCTTCTCGTCGAT 59.613 55.000 0.00 0.0 0.00 3.59
2211 2229 6.043243 AGTTCCAGAACCTAAAGTCTCATGAA 59.957 38.462 6.91 0.0 42.06 2.57
2382 2400 4.669206 TGATTTGGTGCAATGTCTTGTT 57.331 36.364 0.00 0.0 34.69 2.83
2463 2481 5.297527 TCACCTATGCGAAGAGATTAACGTA 59.702 40.000 0.00 0.0 0.00 3.57
2479 2497 8.707449 AGATTAACGTATTGGGTCCTGTATTTA 58.293 33.333 0.00 0.0 0.00 1.40
2647 2665 2.346803 CGATTGGTGTTCCTGAATCGT 58.653 47.619 0.00 0.0 41.02 3.73
2691 2709 1.617947 AAGGCACGCTAGGAGGGAAG 61.618 60.000 0.00 0.0 31.91 3.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1593 1611 1.299240 CAAACAGTGCGTGCATGCA 60.299 52.632 29.30 29.30 43.95 3.96
1743 1761 2.047560 GTACGGTGGCGAGGCTTT 60.048 61.111 0.00 0.00 0.00 3.51
1780 1798 5.073144 AGACTACCTTCAAATCCTTGACCAA 59.927 40.000 0.00 0.00 41.34 3.67
1891 1909 2.426842 AGCTCTTTCCAATAGGGCAC 57.573 50.000 0.00 0.00 41.68 5.01
2049 2067 0.255604 CATGACCCTGGTGTATGCCA 59.744 55.000 0.00 0.00 36.97 4.92
2114 2132 4.616553 TGGTACCTTCATACTAAGCAGGA 58.383 43.478 14.36 0.00 0.00 3.86
2121 2139 4.816126 AGCCAGATGGTACCTTCATACTA 58.184 43.478 25.19 0.00 37.57 1.82
2127 2145 2.482142 CGAGAAGCCAGATGGTACCTTC 60.482 54.545 17.98 17.98 37.57 3.46
2211 2229 0.937304 GCGTCATAATCACGTGGCAT 59.063 50.000 17.00 0.00 39.54 4.40
2382 2400 3.116079 GGGAACACCAACTCGAAACTA 57.884 47.619 0.00 0.00 39.85 2.24
2479 2497 6.969043 TCTCAAAGGGGAACATATTGTGTAT 58.031 36.000 0.00 0.00 41.14 2.29
2647 2665 1.517238 TCCAGTATGCCCTTATGCCA 58.483 50.000 0.00 0.00 31.97 4.92
2660 2678 1.948611 GCGTGCCTTTTCCATCCAGTA 60.949 52.381 0.00 0.00 0.00 2.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.