Multiple sequence alignment - TraesCS2D01G555100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G555100 chr2D 100.000 2288 0 0 1 2288 629241453 629243740 0 4226
1 TraesCS2D01G555100 chr2D 98.042 664 13 0 1 664 487751576 487750913 0 1155
2 TraesCS2D01G555100 chr2D 97.623 673 14 2 1 671 302879376 302880048 0 1153
3 TraesCS2D01G555100 chr2D 97.598 666 14 2 1 664 40766431 40765766 0 1140
4 TraesCS2D01G555100 chr4D 98.744 796 10 0 1493 2288 50741649 50742444 0 1415
5 TraesCS2D01G555100 chr4D 97.892 664 14 0 1 664 228947120 228946457 0 1149
6 TraesCS2D01G555100 chr4D 97.590 664 16 0 1 664 143271430 143270767 0 1138
7 TraesCS2D01G555100 chr1D 98.618 796 11 0 1493 2288 450606920 450607715 0 1410
8 TraesCS2D01G555100 chr1D 98.618 796 11 0 1493 2288 476273024 476272229 0 1410
9 TraesCS2D01G555100 chr1D 98.348 666 11 0 1 666 944815 944150 0 1170
10 TraesCS2D01G555100 chr1D 97.744 665 15 0 1 665 26254069 26254733 0 1146
11 TraesCS2D01G555100 chr7D 98.618 796 10 1 1493 2288 13553676 13552882 0 1408
12 TraesCS2D01G555100 chr7D 98.494 797 12 0 1492 2288 134124534 134125330 0 1406
13 TraesCS2D01G555100 chr7D 98.373 799 13 0 1490 2288 117699985 117700783 0 1404
14 TraesCS2D01G555100 chr7D 95.808 835 29 3 661 1492 621162985 621163816 0 1343
15 TraesCS2D01G555100 chr7D 97.748 666 14 1 1 665 262864021 262864686 0 1146
16 TraesCS2D01G555100 chr5D 98.259 804 12 2 1485 2288 450198269 450197468 0 1406
17 TraesCS2D01G555100 chr5D 98.025 810 13 3 1480 2288 447849900 447849093 0 1404
18 TraesCS2D01G555100 chr3D 98.369 797 13 0 1492 2288 328667254 328666458 0 1400
19 TraesCS2D01G555100 chr3D 97.751 667 14 1 1 666 573055872 573055206 0 1147
20 TraesCS2D01G555100 chr7A 95.187 831 34 3 665 1492 86217684 86216857 0 1308
21 TraesCS2D01G555100 chr2B 94.850 835 36 5 661 1492 643125792 643126622 0 1297
22 TraesCS2D01G555100 chr2B 94.019 836 40 7 661 1491 23891596 23890766 0 1258
23 TraesCS2D01G555100 chr7B 94.139 836 42 4 661 1492 603839720 603840552 0 1266
24 TraesCS2D01G555100 chr7B 94.224 831 42 3 665 1492 494220872 494220045 0 1264
25 TraesCS2D01G555100 chr7B 94.019 836 42 5 661 1492 480271673 480270842 0 1260
26 TraesCS2D01G555100 chr3B 94.139 836 42 5 661 1492 97752217 97751385 0 1266
27 TraesCS2D01G555100 chr2A 94.012 835 44 3 661 1492 706885412 706886243 0 1260


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G555100 chr2D 629241453 629243740 2287 False 4226 4226 100.000 1 2288 1 chr2D.!!$F2 2287
1 TraesCS2D01G555100 chr2D 487750913 487751576 663 True 1155 1155 98.042 1 664 1 chr2D.!!$R2 663
2 TraesCS2D01G555100 chr2D 302879376 302880048 672 False 1153 1153 97.623 1 671 1 chr2D.!!$F1 670
3 TraesCS2D01G555100 chr2D 40765766 40766431 665 True 1140 1140 97.598 1 664 1 chr2D.!!$R1 663
4 TraesCS2D01G555100 chr4D 50741649 50742444 795 False 1415 1415 98.744 1493 2288 1 chr4D.!!$F1 795
5 TraesCS2D01G555100 chr4D 228946457 228947120 663 True 1149 1149 97.892 1 664 1 chr4D.!!$R2 663
6 TraesCS2D01G555100 chr4D 143270767 143271430 663 True 1138 1138 97.590 1 664 1 chr4D.!!$R1 663
7 TraesCS2D01G555100 chr1D 450606920 450607715 795 False 1410 1410 98.618 1493 2288 1 chr1D.!!$F2 795
8 TraesCS2D01G555100 chr1D 476272229 476273024 795 True 1410 1410 98.618 1493 2288 1 chr1D.!!$R2 795
9 TraesCS2D01G555100 chr1D 944150 944815 665 True 1170 1170 98.348 1 666 1 chr1D.!!$R1 665
10 TraesCS2D01G555100 chr1D 26254069 26254733 664 False 1146 1146 97.744 1 665 1 chr1D.!!$F1 664
11 TraesCS2D01G555100 chr7D 13552882 13553676 794 True 1408 1408 98.618 1493 2288 1 chr7D.!!$R1 795
12 TraesCS2D01G555100 chr7D 134124534 134125330 796 False 1406 1406 98.494 1492 2288 1 chr7D.!!$F2 796
13 TraesCS2D01G555100 chr7D 117699985 117700783 798 False 1404 1404 98.373 1490 2288 1 chr7D.!!$F1 798
14 TraesCS2D01G555100 chr7D 621162985 621163816 831 False 1343 1343 95.808 661 1492 1 chr7D.!!$F4 831
15 TraesCS2D01G555100 chr7D 262864021 262864686 665 False 1146 1146 97.748 1 665 1 chr7D.!!$F3 664
16 TraesCS2D01G555100 chr5D 450197468 450198269 801 True 1406 1406 98.259 1485 2288 1 chr5D.!!$R2 803
17 TraesCS2D01G555100 chr5D 447849093 447849900 807 True 1404 1404 98.025 1480 2288 1 chr5D.!!$R1 808
18 TraesCS2D01G555100 chr3D 328666458 328667254 796 True 1400 1400 98.369 1492 2288 1 chr3D.!!$R1 796
19 TraesCS2D01G555100 chr3D 573055206 573055872 666 True 1147 1147 97.751 1 666 1 chr3D.!!$R2 665
20 TraesCS2D01G555100 chr7A 86216857 86217684 827 True 1308 1308 95.187 665 1492 1 chr7A.!!$R1 827
21 TraesCS2D01G555100 chr2B 643125792 643126622 830 False 1297 1297 94.850 661 1492 1 chr2B.!!$F1 831
22 TraesCS2D01G555100 chr2B 23890766 23891596 830 True 1258 1258 94.019 661 1491 1 chr2B.!!$R1 830
23 TraesCS2D01G555100 chr7B 603839720 603840552 832 False 1266 1266 94.139 661 1492 1 chr7B.!!$F1 831
24 TraesCS2D01G555100 chr7B 494220045 494220872 827 True 1264 1264 94.224 665 1492 1 chr7B.!!$R2 827
25 TraesCS2D01G555100 chr7B 480270842 480271673 831 True 1260 1260 94.019 661 1492 1 chr7B.!!$R1 831
26 TraesCS2D01G555100 chr3B 97751385 97752217 832 True 1266 1266 94.139 661 1492 1 chr3B.!!$R1 831
27 TraesCS2D01G555100 chr2A 706885412 706886243 831 False 1260 1260 94.012 661 1492 1 chr2A.!!$F1 831

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
939 944 0.249489 CTACGGCCACTACCATCAGC 60.249 60.0 2.24 0.0 0.0 4.26 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1776 1785 1.983605 AGCAAACGAACTACACGATCG 59.016 47.619 14.88 14.88 42.79 3.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
61 62 6.750501 CAGAAATATGAATGTTGAAGCCACAG 59.249 38.462 0.00 0.00 0.00 3.66
376 380 6.664816 ACATGGACATGACACATAGGAAAAAT 59.335 34.615 18.38 0.00 41.20 1.82
406 410 2.288213 TGGCGCCTAGTCATAGAAATCG 60.288 50.000 29.70 0.00 0.00 3.34
896 901 0.706433 ACAACAAGGGCATGGAGGAT 59.294 50.000 0.00 0.00 0.00 3.24
939 944 0.249489 CTACGGCCACTACCATCAGC 60.249 60.000 2.24 0.00 0.00 4.26
952 957 1.935973 ATCAGCAGGATGGCCCAAT 59.064 52.632 0.00 0.00 37.41 3.16
953 958 0.263765 ATCAGCAGGATGGCCCAATT 59.736 50.000 0.00 0.00 37.41 2.32
954 959 0.925558 TCAGCAGGATGGCCCAATTA 59.074 50.000 0.00 0.00 37.41 1.40
957 962 1.288932 AGCAGGATGGCCCAATTACTT 59.711 47.619 0.00 0.00 37.41 2.24
977 982 2.777832 ACTTCTGCAAGGTCATCCTC 57.222 50.000 0.00 0.00 44.35 3.71
978 983 1.980765 ACTTCTGCAAGGTCATCCTCA 59.019 47.619 0.00 0.00 44.35 3.86
980 985 0.615331 TCTGCAAGGTCATCCTCACC 59.385 55.000 0.00 0.00 44.35 4.02
981 986 0.325933 CTGCAAGGTCATCCTCACCA 59.674 55.000 0.00 0.00 44.35 4.17
1102 1109 1.069978 TGACGGTCAAGCTGATGAACA 59.930 47.619 8.68 0.00 36.82 3.18
1291 1298 3.083997 CCGCCAAGGAGTAGGGCT 61.084 66.667 0.00 0.00 45.53 5.19
1320 1327 5.007823 CACCTCTTTCGAGTGTACTATCGAT 59.992 44.000 19.05 2.16 46.35 3.59
1660 1669 3.283751 GAGCCTCTAGTTGACTAGCTCA 58.716 50.000 18.45 3.26 44.24 4.26
1688 1697 6.795144 TCAATAGATGGTTACGGTTTCCTA 57.205 37.500 0.00 0.00 0.00 2.94
1776 1785 3.181450 ACCCAATCCTAAGCATAGCACTC 60.181 47.826 0.00 0.00 0.00 3.51
1955 1964 0.258774 AGTGTCTGTTGGGTTGGCTT 59.741 50.000 0.00 0.00 0.00 4.35
2104 2113 2.335316 AAAGTGACTTGCCGGTAACA 57.665 45.000 0.00 0.00 0.00 2.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
61 62 4.275936 GCCCCATCTAACAATACATGTGAC 59.724 45.833 9.11 0.00 42.99 3.67
338 341 4.397481 TGTCCATGTGTCAATTTTTGCA 57.603 36.364 0.00 0.00 0.00 4.08
406 410 5.180680 GGTCATAACCTTGTAAGTTGTGGTC 59.819 44.000 0.00 0.00 42.80 4.02
738 743 4.310769 CCCATCTCATTGTTATCCTCGAC 58.689 47.826 0.00 0.00 0.00 4.20
803 808 2.361104 TCGGGCATTGGGTGAAGC 60.361 61.111 0.00 0.00 0.00 3.86
879 884 0.259938 GGATCCTCCATGCCCTTGTT 59.740 55.000 3.84 0.00 36.28 2.83
882 887 3.679755 GGGATCCTCCATGCCCTT 58.320 61.111 12.58 0.00 38.64 3.95
939 944 4.170468 AGTAAGTAATTGGGCCATCCTG 57.830 45.455 7.26 0.00 36.20 3.86
952 957 5.248477 AGGATGACCTTGCAGAAGTAAGTAA 59.752 40.000 0.00 0.00 45.36 2.24
953 958 4.777896 AGGATGACCTTGCAGAAGTAAGTA 59.222 41.667 0.00 0.00 45.36 2.24
954 959 3.584848 AGGATGACCTTGCAGAAGTAAGT 59.415 43.478 0.00 0.00 45.36 2.24
977 982 1.068055 GGATGCACTCAAGCTTTGGTG 60.068 52.381 18.77 18.77 35.96 4.17
978 983 1.251251 GGATGCACTCAAGCTTTGGT 58.749 50.000 0.00 0.00 34.99 3.67
980 985 0.529378 GGGGATGCACTCAAGCTTTG 59.471 55.000 0.00 0.00 34.99 2.77
981 986 0.112995 TGGGGATGCACTCAAGCTTT 59.887 50.000 0.00 0.00 34.99 3.51
1320 1327 6.403866 ACCATAAACATGTTCAAAGCAGAA 57.596 33.333 12.39 0.00 0.00 3.02
1660 1669 7.228706 GGAAACCGTAACCATCTATTGATCAAT 59.771 37.037 23.75 23.75 34.93 2.57
1776 1785 1.983605 AGCAAACGAACTACACGATCG 59.016 47.619 14.88 14.88 42.79 3.69
1898 1907 3.053693 AGTGCACCTTTATAGCCATCCAA 60.054 43.478 14.63 0.00 0.00 3.53
1902 1911 4.444876 CCTGTAGTGCACCTTTATAGCCAT 60.445 45.833 14.63 0.00 0.00 4.40
1955 1964 2.168521 GACAAATCCCAGTCTCGATCCA 59.831 50.000 0.00 0.00 0.00 3.41
2104 2113 4.837093 TCCCAATACCTCGTTCAATCTT 57.163 40.909 0.00 0.00 0.00 2.40
2260 2269 3.433031 CCAATAACCAACAGCGGGATCTA 60.433 47.826 0.00 0.00 0.00 1.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.