Multiple sequence alignment - TraesCS2D01G543000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G543000 chr2D 100.000 2516 0 0 1 2516 621130518 621128003 0.000000e+00 4647
1 TraesCS2D01G543000 chr2D 85.842 1455 156 22 605 2035 621313822 621312394 0.000000e+00 1500
2 TraesCS2D01G543000 chr2D 85.784 1442 160 32 611 2035 621265796 621264383 0.000000e+00 1485
3 TraesCS2D01G543000 chr2D 83.387 313 35 11 2213 2516 621312063 621311759 8.870000e-70 274
4 TraesCS2D01G543000 chr2A 93.190 2364 76 20 136 2488 752978057 752975768 0.000000e+00 3395
5 TraesCS2D01G543000 chr2A 84.992 1226 149 17 826 2035 753004613 753003407 0.000000e+00 1212
6 TraesCS2D01G543000 chr2A 93.944 644 18 7 1 643 753043662 753043039 0.000000e+00 953
7 TraesCS2D01G543000 chr2A 93.617 188 11 1 607 794 752996912 752996726 1.910000e-71 279
8 TraesCS2D01G543000 chr2A 92.632 190 13 1 605 794 753004799 753004611 3.190000e-69 272
9 TraesCS2D01G543000 chr2A 81.789 313 39 9 2213 2516 752994940 752994637 1.930000e-61 246
10 TraesCS2D01G543000 chr2A 81.470 313 40 9 2213 2516 753003076 753002773 8.990000e-60 241
11 TraesCS2D01G543000 chr2A 98.261 115 2 0 1 115 752978575 752978461 4.240000e-48 202
12 TraesCS2D01G543000 chr2A 89.683 126 11 2 611 736 753058489 753058366 2.590000e-35 159
13 TraesCS2D01G543000 chrUn 94.123 2059 83 14 472 2516 314618913 314616879 0.000000e+00 3097
14 TraesCS2D01G543000 chrUn 84.596 1610 181 35 605 2191 338975119 338976684 0.000000e+00 1537
15 TraesCS2D01G543000 chrUn 84.596 1610 181 35 605 2191 342892972 342894537 0.000000e+00 1537
16 TraesCS2D01G543000 chrUn 84.396 1615 192 36 611 2197 342645177 342643595 0.000000e+00 1531
17 TraesCS2D01G543000 chrUn 83.839 1615 191 43 611 2197 343020727 343019155 0.000000e+00 1472
18 TraesCS2D01G543000 chrUn 93.960 149 7 2 333 480 314619485 314619338 9.060000e-55 224
19 TraesCS2D01G543000 chrUn 93.651 126 6 1 185 308 314619608 314619483 1.190000e-43 187
20 TraesCS2D01G543000 chr2B 96.957 1709 49 2 333 2039 762063805 762062098 0.000000e+00 2865
21 TraesCS2D01G543000 chr2B 84.807 1606 182 38 611 2187 762072124 762070552 0.000000e+00 1557
22 TraesCS2D01G543000 chr2B 98.125 480 9 0 2037 2516 762050037 762049558 0.000000e+00 837
23 TraesCS2D01G543000 chr2B 94.498 309 14 3 1 308 762064109 762063803 8.150000e-130 473


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G543000 chr2D 621128003 621130518 2515 True 4647.000000 4647 100.000000 1 2516 1 chr2D.!!$R1 2515
1 TraesCS2D01G543000 chr2D 621264383 621265796 1413 True 1485.000000 1485 85.784000 611 2035 1 chr2D.!!$R2 1424
2 TraesCS2D01G543000 chr2D 621311759 621313822 2063 True 887.000000 1500 84.614500 605 2516 2 chr2D.!!$R3 1911
3 TraesCS2D01G543000 chr2A 752975768 752978575 2807 True 1798.500000 3395 95.725500 1 2488 2 chr2A.!!$R3 2487
4 TraesCS2D01G543000 chr2A 753043039 753043662 623 True 953.000000 953 93.944000 1 643 1 chr2A.!!$R1 642
5 TraesCS2D01G543000 chr2A 753002773 753004799 2026 True 575.000000 1212 86.364667 605 2516 3 chr2A.!!$R5 1911
6 TraesCS2D01G543000 chr2A 752994637 752996912 2275 True 262.500000 279 87.703000 607 2516 2 chr2A.!!$R4 1909
7 TraesCS2D01G543000 chrUn 338975119 338976684 1565 False 1537.000000 1537 84.596000 605 2191 1 chrUn.!!$F1 1586
8 TraesCS2D01G543000 chrUn 342892972 342894537 1565 False 1537.000000 1537 84.596000 605 2191 1 chrUn.!!$F2 1586
9 TraesCS2D01G543000 chrUn 342643595 342645177 1582 True 1531.000000 1531 84.396000 611 2197 1 chrUn.!!$R1 1586
10 TraesCS2D01G543000 chrUn 343019155 343020727 1572 True 1472.000000 1472 83.839000 611 2197 1 chrUn.!!$R2 1586
11 TraesCS2D01G543000 chrUn 314616879 314619608 2729 True 1169.333333 3097 93.911333 185 2516 3 chrUn.!!$R3 2331
12 TraesCS2D01G543000 chr2B 762062098 762064109 2011 True 1669.000000 2865 95.727500 1 2039 2 chr2B.!!$R3 2038
13 TraesCS2D01G543000 chr2B 762070552 762072124 1572 True 1557.000000 1557 84.807000 611 2187 1 chr2B.!!$R2 1576

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
846 1694 0.597118 CCACCAACCGCACATGTTTG 60.597 55.0 0.0 0.0 0.0 2.93 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1999 3149 1.388065 CCAAAAAGCACCCGTCACCA 61.388 55.0 0.0 0.0 0.0 4.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
116 117 9.309516 CGTAAAAGGTCTCTATATAGCAAAACA 57.690 33.333 4.75 0.00 0.00 2.83
152 536 5.043903 TCTTATCAAGCACGAGCAACTATC 58.956 41.667 7.77 0.00 45.49 2.08
204 590 2.578495 GATCACTGTGCTTTTCTTGCG 58.422 47.619 2.12 0.00 0.00 4.85
294 682 1.228245 GGCCATCCGTACCATGCAT 60.228 57.895 0.00 0.00 0.00 3.96
317 705 4.047834 CAGAGTGTTCGGCTGCAA 57.952 55.556 0.50 0.00 0.00 4.08
846 1694 0.597118 CCACCAACCGCACATGTTTG 60.597 55.000 0.00 0.00 0.00 2.93
917 1779 1.271926 TGCCTCCTAGGAAAGCAAACC 60.272 52.381 26.38 5.28 37.67 3.27
1392 2259 2.034532 TCCTCTACGTCACCCGCA 59.965 61.111 0.00 0.00 41.42 5.69
1444 2311 2.651361 CGCCGACACCTGTCTCTT 59.349 61.111 4.00 0.00 42.66 2.85
1532 2401 3.367806 GCTTGAGTGCATCTCTGTAGTCA 60.368 47.826 14.60 0.00 43.17 3.41
1610 2481 9.371136 CTGTGTGTATGATCAAGTAGTTATGTT 57.629 33.333 0.00 0.00 0.00 2.71
1999 3149 1.273495 TGAGAGAGAGCCATGGGAGTT 60.273 52.381 15.13 0.00 0.00 3.01
2224 3553 5.983333 AGATGGTCTGGTAGGAAATGATT 57.017 39.130 0.00 0.00 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
281 669 3.758715 CACAGATGCATGGTACGGA 57.241 52.632 2.46 0.00 0.00 4.69
294 682 1.300931 GCCGAACACTCTGCACAGA 60.301 57.895 0.00 0.00 32.42 3.41
317 705 0.541863 CTACTGATTTGGAGGCCCGT 59.458 55.000 0.00 0.00 34.29 5.28
556 1381 5.097742 TGACGTAGATCCAATTGTCCAAT 57.902 39.130 4.43 0.00 0.00 3.16
779 1624 8.893563 ACCTGGATTTTGGACTTTGAATATTA 57.106 30.769 0.00 0.00 0.00 0.98
917 1779 2.432146 TCGATCCTTGAGTGGAGAATGG 59.568 50.000 0.00 0.00 39.78 3.16
1532 2401 7.880160 ATACATAAAATACACATGTGCCTGT 57.120 32.000 25.68 17.98 34.78 4.00
1570 2439 8.465273 TCATACACACAGATAGTTGCTAGTAT 57.535 34.615 0.00 0.00 0.00 2.12
1610 2481 4.584638 AGCCTGAATACACCCAACATAA 57.415 40.909 0.00 0.00 0.00 1.90
1709 2583 5.818336 TGGTTCTCACGTTTTAGAATGAACA 59.182 36.000 7.74 4.06 34.43 3.18
1999 3149 1.388065 CCAAAAAGCACCCGTCACCA 61.388 55.000 0.00 0.00 0.00 4.17
2326 3661 8.430801 AGTGATGAAAGATTTTCGAAGGATAG 57.569 34.615 0.00 0.00 0.00 2.08
2368 3704 2.248280 TATACAATGGCGCCAACGAT 57.752 45.000 36.33 24.67 43.93 3.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.