Multiple sequence alignment - TraesCS2D01G521900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G521900 chr2D 100.000 2243 0 0 1 2243 610421378 610419136 0.000000e+00 4143
1 TraesCS2D01G521900 chr2D 87.121 132 16 1 1938 2069 22842974 22843104 4.990000e-32 148
2 TraesCS2D01G521900 chr6B 98.087 2248 38 2 1 2243 60080147 60077900 0.000000e+00 3908
3 TraesCS2D01G521900 chr6B 89.985 1378 83 25 760 2097 694395749 694397111 0.000000e+00 1729
4 TraesCS2D01G521900 chr6B 92.308 117 9 0 2075 2191 694397135 694397251 1.380000e-37 167
5 TraesCS2D01G521900 chr7A 92.841 2249 148 9 1 2242 711984943 711987185 0.000000e+00 3249
6 TraesCS2D01G521900 chr7A 91.089 101 8 1 1831 1931 638242232 638242133 3.890000e-28 135
7 TraesCS2D01G521900 chr7D 92.126 2286 117 17 1 2243 570674609 570672344 0.000000e+00 3166
8 TraesCS2D01G521900 chr5D 90.972 2315 120 28 1 2243 432779522 432777225 0.000000e+00 3035
9 TraesCS2D01G521900 chr5D 92.727 165 7 4 2080 2243 432773963 432773803 1.340000e-57 233
10 TraesCS2D01G521900 chr3B 97.098 1654 36 5 596 2243 540479584 540477937 0.000000e+00 2778
11 TraesCS2D01G521900 chr3B 96.196 1104 29 5 1146 2243 71113858 71112762 0.000000e+00 1794
12 TraesCS2D01G521900 chr2A 92.465 1274 93 3 1 1273 25353764 25352493 0.000000e+00 1818
13 TraesCS2D01G521900 chr6A 92.072 1274 96 4 1 1273 282150536 282149267 0.000000e+00 1788
14 TraesCS2D01G521900 chr6A 86.301 876 56 18 1273 2105 21344712 21343858 0.000000e+00 894
15 TraesCS2D01G521900 chr3D 91.771 1276 102 3 1 1275 209670829 209672102 0.000000e+00 1772
16 TraesCS2D01G521900 chr3D 87.390 341 34 4 1220 1555 209672116 209672452 1.260000e-102 383
17 TraesCS2D01G521900 chr4A 90.995 1277 107 7 1 1273 616710502 616711774 0.000000e+00 1714


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G521900 chr2D 610419136 610421378 2242 True 4143.0 4143 100.0000 1 2243 1 chr2D.!!$R1 2242
1 TraesCS2D01G521900 chr6B 60077900 60080147 2247 True 3908.0 3908 98.0870 1 2243 1 chr6B.!!$R1 2242
2 TraesCS2D01G521900 chr6B 694395749 694397251 1502 False 948.0 1729 91.1465 760 2191 2 chr6B.!!$F1 1431
3 TraesCS2D01G521900 chr7A 711984943 711987185 2242 False 3249.0 3249 92.8410 1 2242 1 chr7A.!!$F1 2241
4 TraesCS2D01G521900 chr7D 570672344 570674609 2265 True 3166.0 3166 92.1260 1 2243 1 chr7D.!!$R1 2242
5 TraesCS2D01G521900 chr5D 432773803 432779522 5719 True 1634.0 3035 91.8495 1 2243 2 chr5D.!!$R1 2242
6 TraesCS2D01G521900 chr3B 540477937 540479584 1647 True 2778.0 2778 97.0980 596 2243 1 chr3B.!!$R2 1647
7 TraesCS2D01G521900 chr3B 71112762 71113858 1096 True 1794.0 1794 96.1960 1146 2243 1 chr3B.!!$R1 1097
8 TraesCS2D01G521900 chr2A 25352493 25353764 1271 True 1818.0 1818 92.4650 1 1273 1 chr2A.!!$R1 1272
9 TraesCS2D01G521900 chr6A 282149267 282150536 1269 True 1788.0 1788 92.0720 1 1273 1 chr6A.!!$R2 1272
10 TraesCS2D01G521900 chr6A 21343858 21344712 854 True 894.0 894 86.3010 1273 2105 1 chr6A.!!$R1 832
11 TraesCS2D01G521900 chr3D 209670829 209672452 1623 False 1077.5 1772 89.5805 1 1555 2 chr3D.!!$F1 1554
12 TraesCS2D01G521900 chr4A 616710502 616711774 1272 False 1714.0 1714 90.9950 1 1273 1 chr4A.!!$F1 1272

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
594 597 4.597404 TGTGTGCAATAATTTGGCAGAA 57.403 36.364 0.0 0.0 33.22 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1931 2055 2.967201 CTCTCTGCTCTCCCTGATTGAT 59.033 50.0 0.0 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
135 136 7.775053 TGCAACTTTTCTTAGTGGGAAATAT 57.225 32.000 0.00 0.00 33.51 1.28
461 464 7.052873 ACATATGAAGTAGAGAAGCATGCTTT 58.947 34.615 32.36 21.67 36.26 3.51
594 597 4.597404 TGTGTGCAATAATTTGGCAGAA 57.403 36.364 0.00 0.00 33.22 3.02
697 701 4.974645 TTGTTAGAGAAAAGGAGAGCCA 57.025 40.909 0.00 0.00 36.29 4.75
862 866 4.759183 ACTTGGAGAAAAATGAGTGCTCTC 59.241 41.667 8.86 8.86 40.79 3.20
1074 1078 1.451449 TCCCTCCCAAGCTTACCAAA 58.549 50.000 0.00 0.00 0.00 3.28
1257 1261 6.053005 TCCACGGTAATTATTTCATGAGTCC 58.947 40.000 0.00 0.00 0.00 3.85
1747 1841 2.169789 CGCTCCAGATCAGGTTGCG 61.170 63.158 23.21 23.21 42.29 4.85
1931 2055 7.178274 ACTTGCAGTTATATGGATTTTGGTTCA 59.822 33.333 0.00 0.00 0.00 3.18
2197 2385 1.270625 TGTGTTGAAGAGGTAAGGGCG 60.271 52.381 0.00 0.00 0.00 6.13
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
135 136 1.377987 GGCTGCCAATTGTCCGGTA 60.378 57.895 15.17 0.0 0.00 4.02
461 464 3.282021 GCTTGTATTTCTGCCATCCTGA 58.718 45.455 0.00 0.0 0.00 3.86
697 701 1.815421 CTAGAAGCGCACCGGCAAT 60.815 57.895 11.47 0.0 41.24 3.56
862 866 2.868583 CACAAATCTGCCATCTCCTACG 59.131 50.000 0.00 0.0 0.00 3.51
1931 2055 2.967201 CTCTCTGCTCTCCCTGATTGAT 59.033 50.000 0.00 0.0 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.