Multiple sequence alignment - TraesCS2D01G496800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G496800 chr2D 100.000 2351 0 0 1 2351 593126539 593128889 0.000000e+00 4342.0
1 TraesCS2D01G496800 chr2D 96.501 1686 52 4 1 1682 305961103 305959421 0.000000e+00 2780.0
2 TraesCS2D01G496800 chr2D 96.314 1682 62 0 1 1682 577792528 577790847 0.000000e+00 2763.0
3 TraesCS2D01G496800 chr2D 92.296 675 35 12 1683 2351 593032479 593033142 0.000000e+00 942.0
4 TraesCS2D01G496800 chr2D 78.417 278 41 13 2057 2333 593114902 593115161 1.870000e-36 163.0
5 TraesCS2D01G496800 chr7D 96.376 1683 60 1 1 1683 589251033 589249352 0.000000e+00 2769.0
6 TraesCS2D01G496800 chr7D 96.970 33 1 0 1997 2029 330808144 330808176 3.260000e-04 56.5
7 TraesCS2D01G496800 chrUn 96.314 1682 61 1 1 1682 241760751 241759071 0.000000e+00 2761.0
8 TraesCS2D01G496800 chrUn 96.970 33 1 0 1997 2029 286308716 286308748 3.260000e-04 56.5
9 TraesCS2D01G496800 chrUn 96.970 33 1 0 1997 2029 286314999 286315031 3.260000e-04 56.5
10 TraesCS2D01G496800 chrUn 96.970 33 1 0 1997 2029 295781556 295781524 3.260000e-04 56.5
11 TraesCS2D01G496800 chr3D 96.197 1683 58 2 1 1683 234618662 234620338 0.000000e+00 2748.0
12 TraesCS2D01G496800 chr5D 96.033 1689 64 3 1 1688 40961528 40959842 0.000000e+00 2745.0
13 TraesCS2D01G496800 chr5D 96.021 1684 61 5 1 1682 225859155 225860834 0.000000e+00 2734.0
14 TraesCS2D01G496800 chr4D 96.081 1684 65 1 1 1684 441127901 441129583 0.000000e+00 2743.0
15 TraesCS2D01G496800 chr1D 96.076 1682 57 3 1 1682 303228497 303230169 0.000000e+00 2732.0
16 TraesCS2D01G496800 chr2B 91.554 592 23 7 1766 2351 719154180 719154750 0.000000e+00 791.0
17 TraesCS2D01G496800 chr2B 91.525 118 5 3 1683 1796 719153824 719153940 8.700000e-35 158.0
18 TraesCS2D01G496800 chr6B 91.667 60 3 2 2005 2064 213551135 213551078 5.390000e-12 82.4
19 TraesCS2D01G496800 chr6B 85.484 62 5 1 2004 2061 495438486 495438547 7.020000e-06 62.1
20 TraesCS2D01G496800 chr7A 84.848 66 5 2 2001 2061 310433861 310433796 7.020000e-06 62.1
21 TraesCS2D01G496800 chr4B 96.970 33 1 0 1997 2029 175903802 175903770 3.260000e-04 56.5
22 TraesCS2D01G496800 chr6A 92.308 39 2 1 1998 2035 11784088 11784126 1.000000e-03 54.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G496800 chr2D 593126539 593128889 2350 False 4342.0 4342 100.0000 1 2351 1 chr2D.!!$F3 2350
1 TraesCS2D01G496800 chr2D 305959421 305961103 1682 True 2780.0 2780 96.5010 1 1682 1 chr2D.!!$R1 1681
2 TraesCS2D01G496800 chr2D 577790847 577792528 1681 True 2763.0 2763 96.3140 1 1682 1 chr2D.!!$R2 1681
3 TraesCS2D01G496800 chr2D 593032479 593033142 663 False 942.0 942 92.2960 1683 2351 1 chr2D.!!$F1 668
4 TraesCS2D01G496800 chr7D 589249352 589251033 1681 True 2769.0 2769 96.3760 1 1683 1 chr7D.!!$R1 1682
5 TraesCS2D01G496800 chrUn 241759071 241760751 1680 True 2761.0 2761 96.3140 1 1682 1 chrUn.!!$R1 1681
6 TraesCS2D01G496800 chr3D 234618662 234620338 1676 False 2748.0 2748 96.1970 1 1683 1 chr3D.!!$F1 1682
7 TraesCS2D01G496800 chr5D 40959842 40961528 1686 True 2745.0 2745 96.0330 1 1688 1 chr5D.!!$R1 1687
8 TraesCS2D01G496800 chr5D 225859155 225860834 1679 False 2734.0 2734 96.0210 1 1682 1 chr5D.!!$F1 1681
9 TraesCS2D01G496800 chr4D 441127901 441129583 1682 False 2743.0 2743 96.0810 1 1684 1 chr4D.!!$F1 1683
10 TraesCS2D01G496800 chr1D 303228497 303230169 1672 False 2732.0 2732 96.0760 1 1682 1 chr1D.!!$F1 1681
11 TraesCS2D01G496800 chr2B 719153824 719154750 926 False 474.5 791 91.5395 1683 2351 2 chr2B.!!$F1 668

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
585 586 0.447011 CGAACTCCTCGTCGCTAAGT 59.553 55.0 0.0 0.0 42.89 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2302 2603 0.397816 AGATCAGTAGAAGGGCGCCT 60.398 55.0 28.56 7.3 33.87 5.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
231 232 1.861542 CGTTGCCGATGCCAAGGAAA 61.862 55.000 0.00 0.00 36.33 3.13
585 586 0.447011 CGAACTCCTCGTCGCTAAGT 59.553 55.000 0.00 0.00 42.89 2.24
657 658 1.451747 GGTCGTAGCGGAGGAGTCT 60.452 63.158 0.00 0.00 0.00 3.24
1032 1034 3.235481 TCGAAGTGGAACGGCCCA 61.235 61.111 0.00 0.00 45.86 5.36
1145 1147 3.602677 GATCGGGATCACGGCCGA 61.603 66.667 35.90 15.21 37.74 5.54
1359 1362 1.066573 CCGAAGAACTGAGGCACTGAT 60.067 52.381 0.00 0.00 41.55 2.90
1371 1375 2.693864 ACTGATGGAGCCAGGGGG 60.694 66.667 0.00 0.00 36.03 5.40
1555 1559 7.037438 GGTTAGACTCGATACCATGTAAAACA 58.963 38.462 0.00 0.00 0.00 2.83
1581 1586 1.360393 TTGGGGGAACTGGCTCAACT 61.360 55.000 0.00 0.00 0.00 3.16
1699 1708 8.132362 AGTCTAACAATAGCTGAGTAGAAATCG 58.868 37.037 0.00 0.00 31.44 3.34
1743 1752 9.988350 CAGTAGGTCAAATATGTTTACATGTTC 57.012 33.333 2.30 0.00 36.81 3.18
1935 2223 2.872370 CAAATTGCTGCCAGTCTTAGC 58.128 47.619 0.00 0.00 37.93 3.09
1982 2270 5.318630 TGCATCCGGTATACATCTACTACA 58.681 41.667 0.00 0.00 0.00 2.74
2108 2409 4.099824 GCGTAAATTTATGTTTCCCCGTG 58.900 43.478 16.79 0.00 0.00 4.94
2113 2414 1.757682 TTATGTTTCCCCGTGGATGC 58.242 50.000 0.00 0.00 41.40 3.91
2122 2423 2.401766 CCGTGGATGCCAGCTTGAC 61.402 63.158 0.00 0.00 32.34 3.18
2141 2442 5.562506 TGACGGATTGTGTCTAACTCTAG 57.437 43.478 0.00 0.00 37.26 2.43
2335 2636 6.049149 TCTACTGATCTTGGCTATTTTTCCG 58.951 40.000 0.00 0.00 0.00 4.30
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
231 232 2.262915 CGCCGCTTTCAGAGGAGT 59.737 61.111 0.00 0.00 37.36 3.85
483 484 4.496336 AAGCCAGCGATGCCTCCC 62.496 66.667 0.00 0.00 0.00 4.30
585 586 0.616395 TCACCTCTATTGGTCGGCCA 60.616 55.000 3.51 3.51 44.38 5.36
657 658 0.815095 TCGCCGACATCAAGAAGCTA 59.185 50.000 0.00 0.00 0.00 3.32
812 814 0.178987 GGACCAGGCGATCCTCTCTA 60.179 60.000 0.00 0.00 41.93 2.43
1371 1375 1.376037 CCTCAACCTTCCACCTCGC 60.376 63.158 0.00 0.00 0.00 5.03
1380 1384 4.035102 GCCGCCCTCCTCAACCTT 62.035 66.667 0.00 0.00 0.00 3.50
1465 1469 2.231642 CCCTAAACCCTAGGGCTGG 58.768 63.158 28.88 21.97 46.81 4.85
1555 1559 1.273041 GCCAGTTCCCCCAAAACCTAT 60.273 52.381 0.00 0.00 0.00 2.57
1581 1586 1.213296 GATAGGCCACCCCTTTGAGA 58.787 55.000 5.01 0.00 43.06 3.27
1659 1668 5.909621 TGTTAGACTTCGTATTGTAGCCT 57.090 39.130 0.00 0.00 0.00 4.58
1699 1708 2.137523 CTGGTTGACAAGCATTTTGGC 58.862 47.619 19.65 0.00 38.36 4.52
2042 2343 5.396436 GCTTGCTAGTACTCCCTCCATAAAA 60.396 44.000 0.00 0.00 0.00 1.52
2108 2409 0.749454 AATCCGTCAAGCTGGCATCC 60.749 55.000 0.00 0.00 0.00 3.51
2113 2414 0.798776 GACACAATCCGTCAAGCTGG 59.201 55.000 0.00 0.00 33.43 4.85
2122 2423 4.202030 GGGACTAGAGTTAGACACAATCCG 60.202 50.000 0.00 0.00 0.00 4.18
2141 2442 7.922811 GGATAAGAATGAATGTCAAATTGGGAC 59.077 37.037 4.07 4.07 35.83 4.46
2302 2603 0.397816 AGATCAGTAGAAGGGCGCCT 60.398 55.000 28.56 7.30 33.87 5.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.