Multiple sequence alignment - TraesCS2D01G495000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G495000 chr2D 100.000 2273 0 0 1 2273 591991654 591993926 0 4198
1 TraesCS2D01G495000 chr7B 98.382 2287 23 3 1 2273 622431988 622429702 0 4006
2 TraesCS2D01G495000 chr7B 98.154 1625 18 2 1 1613 662732894 662734518 0 2824
3 TraesCS2D01G495000 chr7B 96.367 633 11 3 1642 2273 71816219 71816840 0 1031
4 TraesCS2D01G495000 chr6B 98.336 2283 27 4 1 2273 515380591 515378310 0 3995
5 TraesCS2D01G495000 chr3B 98.206 2286 28 4 1 2273 201549282 201551567 0 3982
6 TraesCS2D01G495000 chr5D 98.032 2287 29 7 1 2273 503258795 503256511 0 3960
7 TraesCS2D01G495000 chrUn 98.026 1976 23 4 300 2273 331843657 331841696 0 3419
8 TraesCS2D01G495000 chrUn 96.898 1870 17 5 418 2273 354744415 354742573 0 3094
9 TraesCS2D01G495000 chr3D 98.565 1672 22 2 603 2273 158942640 158940970 0 2953
10 TraesCS2D01G495000 chr3D 98.750 1440 17 1 835 2273 589253354 589251915 0 2558
11 TraesCS2D01G495000 chr2A 98.338 1625 15 2 1 1613 543187641 543189265 0 2841
12 TraesCS2D01G495000 chr2A 97.162 1621 36 4 1 1613 394048747 394050365 0 2730
13 TraesCS2D01G495000 chr1D 98.031 1625 19 3 1 1613 254531578 254533201 0 2811
14 TraesCS2D01G495000 chr5B 96.044 1618 48 7 1 1613 432872129 432873735 0 2619
15 TraesCS2D01G495000 chr7D 97.685 1296 15 6 663 1944 231582919 231584213 0 2213
16 TraesCS2D01G495000 chr6D 94.296 561 18 10 1181 1734 449386926 449386373 0 846


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G495000 chr2D 591991654 591993926 2272 False 4198 4198 100.000 1 2273 1 chr2D.!!$F1 2272
1 TraesCS2D01G495000 chr7B 622429702 622431988 2286 True 4006 4006 98.382 1 2273 1 chr7B.!!$R1 2272
2 TraesCS2D01G495000 chr7B 662732894 662734518 1624 False 2824 2824 98.154 1 1613 1 chr7B.!!$F2 1612
3 TraesCS2D01G495000 chr7B 71816219 71816840 621 False 1031 1031 96.367 1642 2273 1 chr7B.!!$F1 631
4 TraesCS2D01G495000 chr6B 515378310 515380591 2281 True 3995 3995 98.336 1 2273 1 chr6B.!!$R1 2272
5 TraesCS2D01G495000 chr3B 201549282 201551567 2285 False 3982 3982 98.206 1 2273 1 chr3B.!!$F1 2272
6 TraesCS2D01G495000 chr5D 503256511 503258795 2284 True 3960 3960 98.032 1 2273 1 chr5D.!!$R1 2272
7 TraesCS2D01G495000 chrUn 331841696 331843657 1961 True 3419 3419 98.026 300 2273 1 chrUn.!!$R1 1973
8 TraesCS2D01G495000 chrUn 354742573 354744415 1842 True 3094 3094 96.898 418 2273 1 chrUn.!!$R2 1855
9 TraesCS2D01G495000 chr3D 158940970 158942640 1670 True 2953 2953 98.565 603 2273 1 chr3D.!!$R1 1670
10 TraesCS2D01G495000 chr3D 589251915 589253354 1439 True 2558 2558 98.750 835 2273 1 chr3D.!!$R2 1438
11 TraesCS2D01G495000 chr2A 543187641 543189265 1624 False 2841 2841 98.338 1 1613 1 chr2A.!!$F2 1612
12 TraesCS2D01G495000 chr2A 394048747 394050365 1618 False 2730 2730 97.162 1 1613 1 chr2A.!!$F1 1612
13 TraesCS2D01G495000 chr1D 254531578 254533201 1623 False 2811 2811 98.031 1 1613 1 chr1D.!!$F1 1612
14 TraesCS2D01G495000 chr5B 432872129 432873735 1606 False 2619 2619 96.044 1 1613 1 chr5B.!!$F1 1612
15 TraesCS2D01G495000 chr7D 231582919 231584213 1294 False 2213 2213 97.685 663 1944 1 chr7D.!!$F1 1281
16 TraesCS2D01G495000 chr6D 449386373 449386926 553 True 846 846 94.296 1181 1734 1 chr6D.!!$R1 553

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1128 1139 2.808543 ACGGAGACTTGCTTCACATTTC 59.191 45.455 0.0 0.0 0.0 2.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2182 2239 5.833131 GGAGGAATTGGTAATGGAATAGCAA 59.167 40.0 1.97 1.97 44.55 3.91 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1128 1139 2.808543 ACGGAGACTTGCTTCACATTTC 59.191 45.455 0.0 0.0 0.0 2.17
1425 1465 5.775701 AGGATATGAGTCTACCGCTTACAAT 59.224 40.000 0.0 0.0 0.0 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2182 2239 5.833131 GGAGGAATTGGTAATGGAATAGCAA 59.167 40.0 1.97 1.97 44.55 3.91


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.