Multiple sequence alignment - TraesCS2D01G463400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G463400 chr2D 100.000 2945 0 0 1 2945 569154515 569151571 0.000000e+00 5439.0
1 TraesCS2D01G463400 chr2D 97.241 1885 48 4 753 2635 569121324 569119442 0.000000e+00 3190.0
2 TraesCS2D01G463400 chr2D 95.853 217 9 0 2729 2945 569091282 569091066 4.670000e-93 351.0
3 TraesCS2D01G463400 chr2D 82.595 316 25 14 276 580 569122036 569121740 4.870000e-63 252.0
4 TraesCS2D01G463400 chr2D 87.310 197 19 5 597 791 569127450 569127642 1.370000e-53 220.0
5 TraesCS2D01G463400 chr2D 74.589 547 99 25 1 542 344311846 344312357 1.380000e-48 204.0
6 TraesCS2D01G463400 chr2D 74.579 594 87 49 1 573 18157964 18158514 4.980000e-48 202.0
7 TraesCS2D01G463400 chr2D 89.796 147 10 4 580 725 569121573 569121431 1.800000e-42 183.0
8 TraesCS2D01G463400 chr2D 92.105 76 5 1 2866 2941 569118326 569118252 4.010000e-19 106.0
9 TraesCS2D01G463400 chr2B 94.751 2172 81 13 633 2792 681943716 681941566 0.000000e+00 3349.0
10 TraesCS2D01G463400 chr2B 96.407 167 6 0 2779 2945 681941550 681941384 2.890000e-70 276.0
11 TraesCS2D01G463400 chr2B 74.530 585 104 26 1 580 409402742 409403286 2.300000e-51 213.0
12 TraesCS2D01G463400 chr2B 79.399 233 35 12 353 579 23885139 23885364 5.080000e-33 152.0
13 TraesCS2D01G463400 chr2B 82.955 176 21 9 1 172 593680556 593680726 1.830000e-32 150.0
14 TraesCS2D01G463400 chr2B 89.286 56 2 4 2814 2867 693193819 693193766 1.890000e-07 67.6
15 TraesCS2D01G463400 chr2A 94.029 1926 74 20 702 2605 708861994 708863900 0.000000e+00 2881.0
16 TraesCS2D01G463400 chr2A 92.079 101 7 1 2724 2824 708863989 708864088 1.100000e-29 141.0
17 TraesCS2D01G463400 chr2A 91.026 78 5 1 2866 2943 708864079 708864154 1.440000e-18 104.0
18 TraesCS2D01G463400 chr2A 84.112 107 11 3 468 573 29228953 29229054 6.720000e-17 99.0
19 TraesCS2D01G463400 chr7D 84.866 1381 186 16 1022 2398 523057010 523055649 0.000000e+00 1371.0
20 TraesCS2D01G463400 chr7D 84.621 1359 184 17 1022 2375 523133800 523132462 0.000000e+00 1328.0
21 TraesCS2D01G463400 chr7D 83.321 1367 186 22 1022 2379 500773766 500775099 0.000000e+00 1223.0
22 TraesCS2D01G463400 chr7D 77.215 316 50 16 2 308 166457105 166457407 6.530000e-37 165.0
23 TraesCS2D01G463400 chr7D 93.333 45 3 0 328 372 617122794 617122838 1.890000e-07 67.6
24 TraesCS2D01G463400 chr7A 84.660 1382 189 16 1022 2399 603331651 603330289 0.000000e+00 1356.0
25 TraesCS2D01G463400 chr7A 83.555 1356 204 13 1022 2375 603553246 603551908 0.000000e+00 1251.0
26 TraesCS2D01G463400 chr7A 83.052 1363 197 15 1022 2379 566788262 566789595 0.000000e+00 1206.0
27 TraesCS2D01G463400 chr7A 77.101 345 62 13 1 340 109818942 109818610 1.800000e-42 183.0
28 TraesCS2D01G463400 chr7B 84.882 1356 186 12 1022 2375 557491593 557490255 0.000000e+00 1351.0
29 TraesCS2D01G463400 chr7B 83.997 1356 195 12 1022 2375 557257419 557256084 0.000000e+00 1282.0
30 TraesCS2D01G463400 chr7B 83.443 1365 187 21 1022 2379 528871662 528872994 0.000000e+00 1232.0
31 TraesCS2D01G463400 chr7B 78.176 307 48 15 1 297 684933396 684933693 8.390000e-41 178.0
32 TraesCS2D01G463400 chr3A 75.000 616 88 35 1 573 12342423 12343015 1.060000e-54 224.0
33 TraesCS2D01G463400 chr3A 79.372 223 37 9 60 278 53290733 53290516 6.580000e-32 148.0
34 TraesCS2D01G463400 chr5A 79.577 284 46 11 1 281 435003370 435003096 3.000000e-45 193.0
35 TraesCS2D01G463400 chrUn 78.176 307 48 15 1 297 397769002 397769299 8.390000e-41 178.0
36 TraesCS2D01G463400 chr1D 76.603 312 57 10 1 305 486903584 486903282 1.090000e-34 158.0
37 TraesCS2D01G463400 chr4A 73.846 455 75 31 155 579 49898605 49899045 1.100000e-29 141.0
38 TraesCS2D01G463400 chr5B 85.271 129 13 6 457 582 354778399 354778274 8.570000e-26 128.0
39 TraesCS2D01G463400 chr4B 81.967 122 14 7 461 580 651759530 651759415 2.420000e-16 97.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G463400 chr2D 569151571 569154515 2944 True 5439.00 5439 100.00000 1 2945 1 chr2D.!!$R2 2944
1 TraesCS2D01G463400 chr2D 569118252 569122036 3784 True 932.75 3190 90.43425 276 2941 4 chr2D.!!$R3 2665
2 TraesCS2D01G463400 chr2D 344311846 344312357 511 False 204.00 204 74.58900 1 542 1 chr2D.!!$F2 541
3 TraesCS2D01G463400 chr2D 18157964 18158514 550 False 202.00 202 74.57900 1 573 1 chr2D.!!$F1 572
4 TraesCS2D01G463400 chr2B 681941384 681943716 2332 True 1812.50 3349 95.57900 633 2945 2 chr2B.!!$R2 2312
5 TraesCS2D01G463400 chr2B 409402742 409403286 544 False 213.00 213 74.53000 1 580 1 chr2B.!!$F2 579
6 TraesCS2D01G463400 chr2A 708861994 708864154 2160 False 1042.00 2881 92.37800 702 2943 3 chr2A.!!$F2 2241
7 TraesCS2D01G463400 chr7D 523055649 523057010 1361 True 1371.00 1371 84.86600 1022 2398 1 chr7D.!!$R1 1376
8 TraesCS2D01G463400 chr7D 523132462 523133800 1338 True 1328.00 1328 84.62100 1022 2375 1 chr7D.!!$R2 1353
9 TraesCS2D01G463400 chr7D 500773766 500775099 1333 False 1223.00 1223 83.32100 1022 2379 1 chr7D.!!$F2 1357
10 TraesCS2D01G463400 chr7A 603330289 603331651 1362 True 1356.00 1356 84.66000 1022 2399 1 chr7A.!!$R2 1377
11 TraesCS2D01G463400 chr7A 603551908 603553246 1338 True 1251.00 1251 83.55500 1022 2375 1 chr7A.!!$R3 1353
12 TraesCS2D01G463400 chr7A 566788262 566789595 1333 False 1206.00 1206 83.05200 1022 2379 1 chr7A.!!$F1 1357
13 TraesCS2D01G463400 chr7B 557490255 557491593 1338 True 1351.00 1351 84.88200 1022 2375 1 chr7B.!!$R2 1353
14 TraesCS2D01G463400 chr7B 557256084 557257419 1335 True 1282.00 1282 83.99700 1022 2375 1 chr7B.!!$R1 1353
15 TraesCS2D01G463400 chr7B 528871662 528872994 1332 False 1232.00 1232 83.44300 1022 2379 1 chr7B.!!$F1 1357
16 TraesCS2D01G463400 chr3A 12342423 12343015 592 False 224.00 224 75.00000 1 573 1 chr3A.!!$F1 572

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
779 1159 1.220749 CCGCCGGAGATTCCTTCAA 59.779 57.895 5.05 0.0 33.3 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2739 4247 1.001974 GGGAAAAGGTTGGGCAATGAC 59.998 52.381 0.0 0.0 0.0 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
206 211 9.730146 CAATTTTCGAATACATTGTCAACATTG 57.270 29.630 0.00 4.03 34.44 2.82
209 214 7.850268 TTCGAATACATTGTCAACATTGTTG 57.150 32.000 21.04 21.04 39.96 3.33
347 466 8.951787 ATGCTTGATTAACATGTTGCAAATAT 57.048 26.923 21.42 14.08 32.88 1.28
349 468 9.866798 TGCTTGATTAACATGTTGCAAATATAA 57.133 25.926 21.42 5.02 0.00 0.98
452 571 2.220824 TGATCAACTTCTTTCACGCACG 59.779 45.455 0.00 0.00 0.00 5.34
455 574 3.188492 TCAACTTCTTTCACGCACGTTA 58.812 40.909 0.00 0.00 0.00 3.18
664 964 4.394610 GCTCAAGGCCTTCTCTCTAAAAAG 59.605 45.833 17.29 0.00 34.27 2.27
779 1159 1.220749 CCGCCGGAGATTCCTTCAA 59.779 57.895 5.05 0.00 33.30 2.69
1083 1485 1.077265 CAACCCCATGCTCCACCTT 59.923 57.895 0.00 0.00 0.00 3.50
1188 1599 2.769617 CGCCTACGTTTGCTGTCG 59.230 61.111 0.00 0.00 33.53 4.35
1831 2242 2.695314 GACCGGTCCGTCGTATACT 58.305 57.895 24.75 0.00 0.00 2.12
1876 2287 1.923227 CTCGTACGAGCAGCTCACCA 61.923 60.000 30.44 3.38 35.31 4.17
2034 2445 2.659610 GCTCCTCAGCTGGACGTT 59.340 61.111 15.13 0.00 43.09 3.99
2508 2921 4.133526 TGGGGGTATTCCATGTCAAAAA 57.866 40.909 0.00 0.00 37.22 1.94
2692 4195 2.294074 GGACCCAATGCGCTATGTAAA 58.706 47.619 9.73 0.00 0.00 2.01
2757 4265 1.611491 TCGTCATTGCCCAACCTTTTC 59.389 47.619 0.00 0.00 0.00 2.29
2762 4270 1.813102 TTGCCCAACCTTTTCCCATT 58.187 45.000 0.00 0.00 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
177 182 9.952188 TGTTGACAATGTATTCGAAAATTGTTA 57.048 25.926 25.38 21.48 41.91 2.41
180 185 9.730146 CAATGTTGACAATGTATTCGAAAATTG 57.270 29.630 20.95 20.95 36.35 2.32
181 186 9.474920 ACAATGTTGACAATGTATTCGAAAATT 57.525 25.926 0.00 0.00 38.14 1.82
187 192 8.894409 ATACAACAATGTTGACAATGTATTCG 57.106 30.769 30.09 1.65 38.90 3.34
223 228 9.160496 TGTTAATCAAGCATTTGAAAAAGTGTT 57.840 25.926 0.00 0.00 45.82 3.32
430 549 3.545633 GTGCGTGAAAGAAGTTGATCAC 58.454 45.455 0.00 0.00 38.98 3.06
573 707 3.057526 AGGCCAAGCAAACGATTTTCTAC 60.058 43.478 5.01 0.00 0.00 2.59
576 710 2.061028 CAGGCCAAGCAAACGATTTTC 58.939 47.619 5.01 0.00 0.00 2.29
601 901 1.651240 CCTGCCGATTGTCAGCTTGG 61.651 60.000 0.00 0.00 0.00 3.61
603 903 0.613260 TACCTGCCGATTGTCAGCTT 59.387 50.000 0.00 0.00 0.00 3.74
610 910 1.095228 ACGCCAATACCTGCCGATTG 61.095 55.000 0.00 0.00 33.63 2.67
611 911 0.814010 GACGCCAATACCTGCCGATT 60.814 55.000 0.00 0.00 0.00 3.34
664 964 2.348362 GCGCAATGTGGCCTAAAATTTC 59.652 45.455 3.32 0.00 0.00 2.17
682 983 0.462581 TCCATCCAACTGATCAGCGC 60.463 55.000 22.83 0.00 0.00 5.92
762 1115 1.221414 GATTGAAGGAATCTCCGGCG 58.779 55.000 0.00 0.00 42.75 6.46
779 1159 4.798882 TGGCAATAAAAATACCTCCGGAT 58.201 39.130 3.57 0.00 0.00 4.18
1188 1599 3.641454 GGGAGGCCATCGGGGATC 61.641 72.222 5.01 0.00 40.01 3.36
1831 2242 3.001514 GATGCTCCCCAGGCTCAA 58.998 61.111 0.00 0.00 0.00 3.02
1876 2287 2.352032 CGAGGCCGGAGAGGAACTT 61.352 63.158 5.05 0.00 41.55 2.66
2057 2468 2.738521 CGGCGTGTGTCAGGAAGG 60.739 66.667 0.00 0.00 0.00 3.46
2298 2709 3.822192 CCGTCGGCGATGTCCAGA 61.822 66.667 25.74 0.00 41.33 3.86
2739 4247 1.001974 GGGAAAAGGTTGGGCAATGAC 59.998 52.381 0.00 0.00 0.00 3.06
2757 4265 7.041107 CCATATTTTAACAACACCTGAATGGG 58.959 38.462 0.00 0.00 41.11 4.00
2762 4270 8.415950 ACAATCCATATTTTAACAACACCTGA 57.584 30.769 0.00 0.00 0.00 3.86
2848 4385 4.855340 AGGCATTTTTCTCGATAAAGGGA 58.145 39.130 0.00 0.00 0.00 4.20


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.