AutoCloner

Multiple sequence alignment - TraesCS2D01G446000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS2D01G446000	chr2D	100.000	3113	0	0	1	3113	556349549	556352661	0.000000e+00	5749.0
1	TraesCS2D01G446000	chr2D	89.224	1494	145	11	825	2307	556267051	556268539	0.000000e+00	1853.0
2	TraesCS2D01G446000	chr2D	82.728	1488	174	36	835	2300	556618970	556620396	0.000000e+00	1247.0
3	TraesCS2D01G446000	chr2D	82.094	1452	167	38	864	2300	556407908	556409281	0.000000e+00	1155.0
4	TraesCS2D01G446000	chr2D	87.857	980	98	9	1347	2306	556339260	556340238	0.000000e+00	1131.0
5	TraesCS2D01G446000	chr2D	81.916	1211	157	32	999	2164	556642397	556643590	0.000000e+00	966.0
6	TraesCS2D01G446000	chr2D	88.123	522	44	8	979	1491	556318394	556318906	3.430000e-169	604.0
7	TraesCS2D01G446000	chr2D	82.090	469	72	7	1487	1953	556333284	556333742	1.050000e-104	390.0
8	TraesCS2D01G446000	chr2D	83.586	396	50	11	2720	3108	556390056	556390443	1.060000e-94	357.0
9	TraesCS2D01G446000	chr2D	84.155	284	38	5	2302	2581	556340284	556340564	5.120000e-68	268.0
10	TraesCS2D01G446000	chr2D	81.333	300	27	18	249	522	556618323	556618619	1.880000e-52	217.0
11	TraesCS2D01G446000	chr2D	85.792	183	12	6	513	681	556265715	556265897	6.860000e-42	182.0
12	TraesCS2D01G446000	chr2D	74.942	431	45	25	269	676	556364678	556365068	4.190000e-29	139.0
13	TraesCS2D01G446000	chr2D	95.238	84	4	0	688	771	556265940	556266023	1.950000e-27	134.0
14	TraesCS2D01G446000	chr2D	81.111	180	15	10	55	220	556618052	556618226	3.260000e-25	126.0
15	TraesCS2D01G446000	chr2D	93.939	66	4	0	2166	2231	556643644	556643709	1.980000e-17	100.0
16	TraesCS2D01G446000	chr2D	90.667	75	5	1	56	128	556364002	556364076	7.100000e-17	99.0
17	TraesCS2D01G446000	chr2D	87.500	72	3	1	63	128	556265200	556265271	9.260000e-11	78.7
18	TraesCS2D01G446000	chr2A	90.068	1329	120	8	979	2306	696040411	696041728	0.000000e+00	1712.0
19	TraesCS2D01G446000	chr2A	85.912	1519	164	27	825	2306	695998938	696000443	0.000000e+00	1574.0
20	TraesCS2D01G446000	chr2A	87.632	760	69	15	864	1598	696306895	696307654	0.000000e+00	859.0
21	TraesCS2D01G446000	chr2A	91.353	266	19	3	2043	2306	696001156	696001419	8.210000e-96	361.0
22	TraesCS2D01G446000	chr2A	83.624	287	39	6	2302	2584	696041774	696042056	2.380000e-66	263.0
23	TraesCS2D01G446000	chr2A	90.714	140	13	0	687	826	695998769	695998908	1.470000e-43	187.0
24	TraesCS2D01G446000	chr2A	75.468	481	50	25	219	676	696218401	696218836	4.130000e-39	172.0
25	TraesCS2D01G446000	chr2A	84.328	134	14	2	2166	2292	696826489	696826622	1.170000e-24	124.0
26	TraesCS2D01G446000	chr2A	81.159	138	18	3	2166	2295	696316838	696316975	1.530000e-18	104.0
27	TraesCS2D01G446000	chr2A	88.571	70	2	2	65	128	695998112	695998181	2.570000e-11	80.5
28	TraesCS2D01G446000	chr2B	86.879	1509	157	23	825	2305	663828794	663830289	0.000000e+00	1652.0
29	TraesCS2D01G446000	chr2B	85.605	1438	147	27	864	2288	663837874	663839264	0.000000e+00	1454.0
30	TraesCS2D01G446000	chr2B	81.706	1454	160	51	866	2300	663885893	663887259	0.000000e+00	1114.0
31	TraesCS2D01G446000	chr2B	84.047	934	140	5	1380	2306	663180828	663179897	0.000000e+00	891.0
32	TraesCS2D01G446000	chr2B	90.698	387	32	4	242	626	663835082	663835466	2.140000e-141	512.0
33	TraesCS2D01G446000	chr2B	83.959	293	33	10	2829	3113	663831242	663831528	5.120000e-68	268.0
34	TraesCS2D01G446000	chr2B	92.143	140	11	0	687	826	663828625	663828764	6.810000e-47	198.0
35	TraesCS2D01G446000	chr2B	89.933	149	12	3	536	681	663828438	663828586	4.100000e-44	189.0
36	TraesCS2D01G446000	chr2B	86.335	161	7	2	17	168	663832920	663833074	8.930000e-36	161.0
37	TraesCS2D01G446000	chr2B	84.337	166	17	4	219	380	663885249	663885409	1.500000e-33	154.0
38	TraesCS2D01G446000	chr2B	85.065	154	11	7	219	369	663827866	663828010	2.500000e-31	147.0
39	TraesCS2D01G446000	chr2B	84.559	136	14	2	2166	2294	663899999	663900134	9.060000e-26	128.0
40	TraesCS2D01G446000	chr2B	94.118	68	1	2	153	220	663834480	663834544	1.980000e-17	100.0
41	TraesCS2D01G446000	chr2B	95.161	62	3	0	620	681	663837568	663837629	7.100000e-17	99.0
42	TraesCS2D01G446000	chr2B	88.889	72	2	2	63	128	663827682	663827753	1.990000e-12	84.2
43	TraesCS2D01G446000	chr1A	75.389	321	67	8	1811	2126	459441787	459441474	9.000000e-31	145.0
44	TraesCS2D01G446000	chr7D	86.765	68	9	0	2624	2691	80767084	80767017	3.330000e-10	76.8

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS2D01G446000	chr2D	556349549	556352661	3112	False	5749.000	5749	100.000000	1	3113	1	chr2D.!!$F3	3112
1	TraesCS2D01G446000	chr2D	556407908	556409281	1373	False	1155.000	1155	82.094000	864	2300	1	chr2D.!!$F5	1436
2	TraesCS2D01G446000	chr2D	556339260	556340564	1304	False	699.500	1131	86.006000	1347	2581	2	chr2D.!!$F7	1234
3	TraesCS2D01G446000	chr2D	556318394	556318906	512	False	604.000	604	88.123000	979	1491	1	chr2D.!!$F1	512
4	TraesCS2D01G446000	chr2D	556265200	556268539	3339	False	561.925	1853	89.438500	63	2307	4	chr2D.!!$F6	2244
5	TraesCS2D01G446000	chr2D	556642397	556643709	1312	False	533.000	966	87.927500	999	2231	2	chr2D.!!$F10	1232
6	TraesCS2D01G446000	chr2D	556618052	556620396	2344	False	530.000	1247	81.724000	55	2300	3	chr2D.!!$F9	2245
7	TraesCS2D01G446000	chr2A	696040411	696042056	1645	False	987.500	1712	86.846000	979	2584	2	chr2A.!!$F6	1605
8	TraesCS2D01G446000	chr2A	696306895	696307654	759	False	859.000	859	87.632000	864	1598	1	chr2A.!!$F2	734
9	TraesCS2D01G446000	chr2A	695998112	696001419	3307	False	550.625	1574	89.137500	65	2306	4	chr2A.!!$F5	2241
10	TraesCS2D01G446000	chr2B	663179897	663180828	931	True	891.000	891	84.047000	1380	2306	1	chr2B.!!$R1	926
11	TraesCS2D01G446000	chr2B	663885249	663887259	2010	False	634.000	1114	83.021500	219	2300	2	chr2B.!!$F3	2081
12	TraesCS2D01G446000	chr2B	663827682	663839264	11582	False	442.200	1652	88.980455	17	3113	11	chr2B.!!$F2	3096

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Hairpin	End Stability	Orientation
265	366	0.038166	CTGCCTAACCTTTGGGAGCA	59.962	55.0	0.00	35.19	4.26	F
267	368	0.038310	GCCTAACCTTTGGGAGCAGT	59.962	55.0	0.00	32.08	4.40	F
414	776	0.179134	CGTCGGATCCAGAGACCAAC	60.179	60.0	13.41	0.00	3.77	F

Position	MSA Position	Penalty	Sequence	TM	GC	Hairpin	End Stability	Orientation
1233	2729	0.179000	GGAGGTTGATGATGAGGCGT	59.821	55.0	0.00	5.68	R
2019	3634	0.179009	CCATCGTGGGCTCCATCAAT	60.179	55.0	35.28	2.57	R
2344	5050	0.958382	GCCACGCTCCAACCATAACA	60.958	55.0	0.00	2.41	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
29	30	3.830465	AAAAACCACGTCCGGGTG	58.170	55.556	0.00	2.09	39.01	4.61
30	31	2.483197	AAAAACCACGTCCGGGTGC	61.483	57.895	0.00	0.00	39.01	5.01
31	32	3.700831	AAAACCACGTCCGGGTGCA	62.701	57.895	0.00	0.00	39.01	4.57
32	33	2.969300	AAAACCACGTCCGGGTGCAT	62.969	55.000	0.00	0.00	39.01	3.96
33	34	4.697756	ACCACGTCCGGGTGCATG	62.698	66.667	0.00	0.00	37.23	4.06
53	54	4.111016	CACGGCTCGGCTACACGA	62.111	66.667	0.00	0.00	41.13	4.35
54	55	3.367743	ACGGCTCGGCTACACGAA	61.368	61.111	0.00	0.00	42.98	3.85
55	56	2.879462	CGGCTCGGCTACACGAAC	60.879	66.667	0.00	0.00	42.98	3.95
56	57	2.260434	GGCTCGGCTACACGAACA	59.740	61.111	0.00	0.00	42.98	3.18
57	58	2.092882	GGCTCGGCTACACGAACAC	61.093	63.158	0.00	0.00	42.98	3.32
58	59	2.434134	GCTCGGCTACACGAACACG	61.434	63.158	0.00	0.00	42.98	4.49
59	60	1.800315	CTCGGCTACACGAACACGG	60.800	63.158	0.00	0.00	42.98	4.94
60	61	2.807895	CGGCTACACGAACACGGG	60.808	66.667	0.00	0.00	35.47	5.28
61	62	2.341176	GGCTACACGAACACGGGT	59.659	61.111	2.66	2.66	45.70	5.28
166	195	0.455815	GCCATGTCCCGTGGAAAATC	59.544	55.000	6.66	0.00	42.73	2.17
170	199	2.178912	TGTCCCGTGGAAAATCTGAC	57.821	50.000	0.00	0.00	31.38	3.51
199	285	4.187056	GCTACAAGAGCCACGGTC	57.813	61.111	0.00	0.00	46.41	4.79
200	286	1.292223	GCTACAAGAGCCACGGTCA	59.708	57.895	0.00	0.00	46.41	4.02
201	287	0.108138	GCTACAAGAGCCACGGTCAT	60.108	55.000	0.00	0.00	46.41	3.06
203	289	1.204704	CTACAAGAGCCACGGTCATGA	59.795	52.381	3.39	0.00	33.79	3.07
204	290	0.615331	ACAAGAGCCACGGTCATGAT	59.385	50.000	0.00	0.00	33.79	2.45
205	291	1.012086	CAAGAGCCACGGTCATGATG	58.988	55.000	0.00	0.00	31.68	3.07
206	292	0.904649	AAGAGCCACGGTCATGATGA	59.095	50.000	0.00	0.00	31.89	2.92
207	293	0.463204	AGAGCCACGGTCATGATGAG	59.537	55.000	0.00	0.00	31.89	2.90
208	294	1.153289	AGCCACGGTCATGATGAGC	60.153	57.895	14.25	14.25	41.16	4.26

Showing 1 to 25 of 214 entries

Previous1 2 3 4 5…9Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Hairpin	End Stability
12	13	2.483197	GCACCCGGACGTGGTTTTT	61.483	57.895	0.73	32.46	1.94
13	14	2.903350	GCACCCGGACGTGGTTTT	60.903	61.111	0.73	32.46	2.43
14	15	3.485346	ATGCACCCGGACGTGGTTT	62.485	57.895	0.73	32.46	3.27
15	16	3.948719	ATGCACCCGGACGTGGTT	61.949	61.111	0.73	32.46	3.67
16	17	4.697756	CATGCACCCGGACGTGGT	62.698	66.667	0.73	36.21	4.16
36	37	3.620300	TTCGTGTAGCCGAGCCGTG	62.620	63.158	0.00	38.23	4.94
37	38	3.367743	TTCGTGTAGCCGAGCCGT	61.368	61.111	0.00	38.23	5.68
38	39	2.879462	GTTCGTGTAGCCGAGCCG	60.879	66.667	0.00	38.23	5.52
39	40	2.092882	GTGTTCGTGTAGCCGAGCC	61.093	63.158	0.00	37.28	4.70
40	41	2.434134	CGTGTTCGTGTAGCCGAGC	61.434	63.158	0.00	38.23	5.03
41	42	1.800315	CCGTGTTCGTGTAGCCGAG	60.800	63.158	0.00	38.23	4.63
42	43	2.256158	CCGTGTTCGTGTAGCCGA	59.744	61.111	0.00	35.01	5.54
43	44	2.807895	CCCGTGTTCGTGTAGCCG	60.808	66.667	0.00	35.01	5.52
44	45	1.287041	GAACCCGTGTTCGTGTAGCC	61.287	60.000	0.00	41.35	3.93
45	46	2.147820	GAACCCGTGTTCGTGTAGC	58.852	57.895	0.00	41.35	3.58
53	54	2.322658	TCCACTAGAAGAACCCGTGTT	58.677	47.619	0.00	37.42	3.32
54	55	2.005370	TCCACTAGAAGAACCCGTGT	57.995	50.000	0.00	0.00	4.49
55	56	2.496070	TGATCCACTAGAAGAACCCGTG	59.504	50.000	0.00	0.00	4.94
56	57	2.761208	CTGATCCACTAGAAGAACCCGT	59.239	50.000	0.00	0.00	5.28
57	58	2.101582	CCTGATCCACTAGAAGAACCCG	59.898	54.545	0.00	0.00	5.28
58	59	3.108376	ACCTGATCCACTAGAAGAACCC	58.892	50.000	0.00	0.00	4.11
59	60	3.118592	CCACCTGATCCACTAGAAGAACC	60.119	52.174	0.00	0.00	3.62
60	61	3.680196	GCCACCTGATCCACTAGAAGAAC	60.680	52.174	0.00	0.00	3.01
61	62	2.501723	GCCACCTGATCCACTAGAAGAA	59.498	50.000	0.00	0.00	2.52
116	125	0.253327	GACTCGGGGCCATTTCTTCT	59.747	55.000	4.39	0.00	2.85

Showing 1 to 25 of 237 entries

Previous1 2 3 4 5…10Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.