Multiple sequence alignment - TraesCS2D01G438300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G438300 chr2D 100.000 2318 0 0 1 2318 547792254 547789937 0.000000e+00 4281.0
1 TraesCS2D01G438300 chr2D 79.737 2359 325 81 9 2318 547775996 547773742 0.000000e+00 1567.0
2 TraesCS2D01G438300 chr2D 92.997 971 56 5 1359 2318 547899934 547898965 0.000000e+00 1406.0
3 TraesCS2D01G438300 chr2D 90.754 995 74 10 378 1363 547918286 547917301 0.000000e+00 1312.0
4 TraesCS2D01G438300 chr2D 96.000 300 12 0 87 386 547945471 547945172 2.680000e-134 488.0
5 TraesCS2D01G438300 chr2D 100.000 36 0 0 1 36 547945505 547945470 1.490000e-07 67.6
6 TraesCS2D01G438300 chr2A 92.800 2000 105 17 346 2318 691139620 691141607 0.000000e+00 2859.0
7 TraesCS2D01G438300 chr2A 91.940 1613 117 10 1 1605 691118964 691120571 0.000000e+00 2246.0
8 TraesCS2D01G438300 chr2A 82.910 1773 232 48 312 2059 691115438 691117164 0.000000e+00 1530.0
9 TraesCS2D01G438300 chr2A 90.798 652 52 5 1583 2230 691120576 691121223 0.000000e+00 865.0
10 TraesCS2D01G438300 chr2A 95.198 354 15 2 1 354 691137470 691137821 2.010000e-155 558.0
11 TraesCS2D01G438300 chrUn 95.091 1711 69 7 1 1704 248123667 248121965 0.000000e+00 2680.0
12 TraesCS2D01G438300 chrUn 97.169 883 24 1 1 883 346479511 346480392 0.000000e+00 1491.0
13 TraesCS2D01G438300 chrUn 90.575 626 49 5 1702 2318 281906488 281907112 0.000000e+00 821.0
14 TraesCS2D01G438300 chrUn 90.415 626 49 6 1702 2318 248121883 248121260 0.000000e+00 813.0
15 TraesCS2D01G438300 chrUn 91.549 284 18 3 2040 2318 422207271 422206989 1.000000e-103 387.0
16 TraesCS2D01G438300 chr2B 95.035 1712 68 9 1 1704 654650232 654648530 0.000000e+00 2675.0
17 TraesCS2D01G438300 chr2B 94.857 1711 73 7 1 1704 654727814 654726112 0.000000e+00 2658.0
18 TraesCS2D01G438300 chr2B 93.805 1711 72 12 1 1704 654700336 654698653 0.000000e+00 2542.0
19 TraesCS2D01G438300 chr2B 93.065 1240 72 7 661 1895 654546523 654545293 0.000000e+00 1801.0
20 TraesCS2D01G438300 chr2B 80.984 1504 226 33 832 2318 654422413 654420953 0.000000e+00 1138.0
21 TraesCS2D01G438300 chr2B 90.575 626 49 5 1702 2318 654648448 654647824 0.000000e+00 821.0
22 TraesCS2D01G438300 chr2B 90.415 626 50 5 1702 2318 654698572 654697948 0.000000e+00 815.0
23 TraesCS2D01G438300 chr2B 90.415 626 50 5 1702 2318 654726030 654725406 0.000000e+00 815.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G438300 chr2D 547789937 547792254 2317 True 4281.0 4281 100.000000 1 2318 1 chr2D.!!$R2 2317
1 TraesCS2D01G438300 chr2D 547773742 547775996 2254 True 1567.0 1567 79.737000 9 2318 1 chr2D.!!$R1 2309
2 TraesCS2D01G438300 chr2D 547898965 547899934 969 True 1406.0 1406 92.997000 1359 2318 1 chr2D.!!$R3 959
3 TraesCS2D01G438300 chr2D 547917301 547918286 985 True 1312.0 1312 90.754000 378 1363 1 chr2D.!!$R4 985
4 TraesCS2D01G438300 chr2A 691137470 691141607 4137 False 1708.5 2859 93.999000 1 2318 2 chr2A.!!$F2 2317
5 TraesCS2D01G438300 chr2A 691115438 691121223 5785 False 1547.0 2246 88.549333 1 2230 3 chr2A.!!$F1 2229
6 TraesCS2D01G438300 chrUn 248121260 248123667 2407 True 1746.5 2680 92.753000 1 2318 2 chrUn.!!$R2 2317
7 TraesCS2D01G438300 chrUn 346479511 346480392 881 False 1491.0 1491 97.169000 1 883 1 chrUn.!!$F2 882
8 TraesCS2D01G438300 chrUn 281906488 281907112 624 False 821.0 821 90.575000 1702 2318 1 chrUn.!!$F1 616
9 TraesCS2D01G438300 chr2B 654545293 654546523 1230 True 1801.0 1801 93.065000 661 1895 1 chr2B.!!$R2 1234
10 TraesCS2D01G438300 chr2B 654647824 654650232 2408 True 1748.0 2675 92.805000 1 2318 2 chr2B.!!$R3 2317
11 TraesCS2D01G438300 chr2B 654725406 654727814 2408 True 1736.5 2658 92.636000 1 2318 2 chr2B.!!$R5 2317
12 TraesCS2D01G438300 chr2B 654697948 654700336 2388 True 1678.5 2542 92.110000 1 2318 2 chr2B.!!$R4 2317
13 TraesCS2D01G438300 chr2B 654420953 654422413 1460 True 1138.0 1138 80.984000 832 2318 1 chr2B.!!$R1 1486

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
603 5962 0.037975 CGGAAGGCATGCAAAAAGCT 60.038 50.0 21.36 2.68 45.94 3.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2001 7528 0.599991 TAGTGAGTTGTGCTGGCGTG 60.6 55.0 0.0 0.0 0.0 5.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
62 3589 1.004044 CCACCAGTCCAAGATCAAGCT 59.996 52.381 0.00 0.00 0.00 3.74
233 3760 2.689983 GGGGAGGAAATGCAATGTACTG 59.310 50.000 0.00 0.00 0.00 2.74
265 3792 8.523658 TCAGTAATAGGTGCATATACATGACTC 58.476 37.037 0.00 0.00 33.67 3.36
463 5822 8.531982 AGCGCTAATGAAGTCATTCCTATAATA 58.468 33.333 8.99 0.00 44.67 0.98
603 5962 0.037975 CGGAAGGCATGCAAAAAGCT 60.038 50.000 21.36 2.68 45.94 3.74
955 6328 6.918067 AAAGCCTAGCTAAGACCAAAAATT 57.082 33.333 0.00 0.00 38.25 1.82
961 6334 6.801862 CCTAGCTAAGACCAAAAATTTTCACG 59.198 38.462 3.41 0.00 0.00 4.35
967 6340 2.939756 ACCAAAAATTTTCACGGGCAAC 59.060 40.909 3.41 0.00 0.00 4.17
1004 6377 6.469782 AATAATAGAACAAACAGCCATGGG 57.530 37.500 15.13 0.00 0.00 4.00
1548 6947 2.267351 TGCCTTGCATGTTGTCCCG 61.267 57.895 0.00 0.00 31.71 5.14
1895 7417 5.700832 AGCACAACAGATCGTTCAGAATTTA 59.299 36.000 0.00 0.00 34.86 1.40
2001 7528 8.075574 TGATTCGCATAATCAAACATAATGTCC 58.924 33.333 8.60 0.00 34.07 4.02
2213 7753 0.461961 CTACTTCGCTGAAGGAGGGG 59.538 60.000 17.66 0.31 44.46 4.79
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
62 3589 6.874278 TTCTTCAGACCATAGAGGAAATCA 57.126 37.500 0.00 0.00 41.22 2.57
463 5822 0.249741 GGTATATGTTCCGCTGCCGT 60.250 55.000 0.00 0.00 0.00 5.68
584 5943 0.037975 AGCTTTTTGCATGCCTTCCG 60.038 50.000 16.68 2.01 45.94 4.30
603 5962 1.974265 TCGATTTGCCCAGTCACAAA 58.026 45.000 0.00 0.00 39.87 2.83
829 6201 3.772060 GCATCAAGCAAGAACTTAGGG 57.228 47.619 0.00 0.00 44.79 3.53
955 6328 1.141254 TCTAGTTGGTTGCCCGTGAAA 59.859 47.619 0.00 0.00 0.00 2.69
961 6334 5.914898 ATTTTGTATCTAGTTGGTTGCCC 57.085 39.130 0.00 0.00 0.00 5.36
989 6362 2.890945 GACTTACCCATGGCTGTTTGTT 59.109 45.455 6.09 0.00 0.00 2.83
1278 6651 2.031163 GTGAGACCGCACTTGCCT 59.969 61.111 0.00 0.00 37.91 4.75
1571 6970 3.672241 GCAACCTTTTGACACGAACAACT 60.672 43.478 0.00 0.00 34.24 3.16
1618 7044 7.094805 CCAATAGGAAAAGAAGTTGTGATCGAA 60.095 37.037 0.00 0.00 36.89 3.71
1774 7289 3.126858 CACCATAGGACGTGGATGTTTTG 59.873 47.826 0.00 0.00 39.12 2.44
1895 7417 0.909610 TGCTTTCCGGGATCACCTCT 60.910 55.000 0.00 0.00 36.97 3.69
1980 7507 5.620822 CGTGGACATTATGTTTGATTATGCG 59.379 40.000 0.00 0.00 0.00 4.73
2001 7528 0.599991 TAGTGAGTTGTGCTGGCGTG 60.600 55.000 0.00 0.00 0.00 5.34
2213 7753 6.074356 GGACATTTTTGTATTGTTGTGAGTGC 60.074 38.462 0.00 0.00 0.00 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.