Multiple sequence alignment - TraesCS2D01G434400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G434400 chr2D 100.000 3626 0 0 1 3626 545729912 545726287 0.000000e+00 6697.0
1 TraesCS2D01G434400 chr2D 89.082 2876 255 41 769 3605 584234607 584237462 0.000000e+00 3517.0
2 TraesCS2D01G434400 chr2D 84.699 1745 203 33 1915 3617 580971654 580973376 0.000000e+00 1685.0
3 TraesCS2D01G434400 chr2D 87.513 929 108 5 789 1710 580970459 580971386 0.000000e+00 1066.0
4 TraesCS2D01G434400 chr2D 76.712 1782 287 57 1197 2914 582503815 582502098 0.000000e+00 874.0
5 TraesCS2D01G434400 chr2D 77.620 1412 231 48 2135 3490 435926301 435927683 0.000000e+00 778.0
6 TraesCS2D01G434400 chr2D 86.259 735 62 12 25 752 584233934 584234636 0.000000e+00 761.0
7 TraesCS2D01G434400 chr2D 75.000 1124 204 36 868 1950 435925008 435926095 7.140000e-122 448.0
8 TraesCS2D01G434400 chr2D 88.587 184 17 2 391 570 580970190 580970373 1.690000e-53 220.0
9 TraesCS2D01G434400 chr2D 87.200 125 9 6 619 743 580970365 580970482 6.320000e-28 135.0
10 TraesCS2D01G434400 chr2D 90.789 76 7 0 2069 2144 580971841 580971916 6.410000e-18 102.0
11 TraesCS2D01G434400 chr2D 91.667 60 4 1 420 478 582546494 582546435 8.340000e-12 82.4
12 TraesCS2D01G434400 chr2A 98.192 3651 32 6 1 3626 687312102 687315743 0.000000e+00 6346.0
13 TraesCS2D01G434400 chr2B 89.159 2878 258 36 769 3605 703349852 703352716 0.000000e+00 3537.0
14 TraesCS2D01G434400 chr2B 86.641 1572 179 15 2070 3617 700206949 700208513 0.000000e+00 1711.0
15 TraesCS2D01G434400 chr2B 77.782 2597 415 93 979 3485 701503285 701500761 0.000000e+00 1450.0
16 TraesCS2D01G434400 chr2B 86.975 929 113 5 789 1710 700205575 700206502 0.000000e+00 1038.0
17 TraesCS2D01G434400 chr2B 86.957 736 63 17 25 752 703349171 703349881 0.000000e+00 797.0
18 TraesCS2D01G434400 chr2B 77.675 1411 231 51 2135 3490 515049332 515047951 0.000000e+00 784.0
19 TraesCS2D01G434400 chr2B 74.956 1134 207 37 868 1960 515050646 515049549 1.990000e-122 449.0
20 TraesCS2D01G434400 chr2B 83.775 302 31 7 63 349 700205059 700205357 1.660000e-68 270.0
21 TraesCS2D01G434400 chr2B 91.667 60 4 1 420 478 701506377 701506318 8.340000e-12 82.4
22 TraesCS2D01G434400 chr4A 81.858 226 37 4 2931 3154 603748828 603748605 1.720000e-43 187.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G434400 chr2D 545726287 545729912 3625 True 6697.000000 6697 100.0000 1 3626 1 chr2D.!!$R1 3625
1 TraesCS2D01G434400 chr2D 584233934 584237462 3528 False 2139.000000 3517 87.6705 25 3605 2 chr2D.!!$F3 3580
2 TraesCS2D01G434400 chr2D 582502098 582503815 1717 True 874.000000 874 76.7120 1197 2914 1 chr2D.!!$R2 1717
3 TraesCS2D01G434400 chr2D 580970190 580973376 3186 False 641.600000 1685 87.7576 391 3617 5 chr2D.!!$F2 3226
4 TraesCS2D01G434400 chr2D 435925008 435927683 2675 False 613.000000 778 76.3100 868 3490 2 chr2D.!!$F1 2622
5 TraesCS2D01G434400 chr2A 687312102 687315743 3641 False 6346.000000 6346 98.1920 1 3626 1 chr2A.!!$F1 3625
6 TraesCS2D01G434400 chr2B 703349171 703352716 3545 False 2167.000000 3537 88.0580 25 3605 2 chr2B.!!$F2 3580
7 TraesCS2D01G434400 chr2B 700205059 700208513 3454 False 1006.333333 1711 85.7970 63 3617 3 chr2B.!!$F1 3554
8 TraesCS2D01G434400 chr2B 701500761 701506377 5616 True 766.200000 1450 84.7245 420 3485 2 chr2B.!!$R2 3065
9 TraesCS2D01G434400 chr2B 515047951 515050646 2695 True 616.500000 784 76.3155 868 3490 2 chr2B.!!$R1 2622

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
116 123 6.381707 TGTGTAGCTTATATGCCCCGATTATA 59.618 38.462 6.97 0.00 0.00 0.98 F
1095 3819 1.740025 GAAGACATGCTAAAGCGGCTT 59.260 47.619 9.94 9.94 45.83 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1613 4352 0.405585 AGCTTTAAGGGCTGCCAGAA 59.594 50.0 22.05 8.02 38.73 3.02 R
2995 6009 1.298157 GCTGCTCCATTACGTGCACA 61.298 55.0 18.64 0.00 0.00 4.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
38 39 8.969734 TGGGGATAGTTAGGTATAGTTAACCTA 58.030 37.037 0.88 0.00 45.69 3.08
116 123 6.381707 TGTGTAGCTTATATGCCCCGATTATA 59.618 38.462 6.97 0.00 0.00 0.98
343 374 7.211573 TCCATCAATTTTTGCTATAAGGCATG 58.788 34.615 0.00 0.00 42.09 4.06
825 3153 6.770785 AGTATTTTAGTTGTGACTTCAAGGCA 59.229 34.615 0.00 0.00 37.33 4.75
1095 3819 1.740025 GAAGACATGCTAAAGCGGCTT 59.260 47.619 9.94 9.94 45.83 4.35
1613 4352 1.903183 GGTGCTAGGTTCTCAAGTCCT 59.097 52.381 0.00 0.00 35.60 3.85
1754 4535 1.065199 CCCAGAGGCAGCATTTGAGTA 60.065 52.381 0.00 0.00 0.00 2.59
1816 4597 2.159043 CCCGACATAGAAGTGCTGATGT 60.159 50.000 0.00 0.00 35.26 3.06
2624 5596 6.978080 GCAAAGTCAAGGTCAAAGTCAAATTA 59.022 34.615 0.00 0.00 0.00 1.40
2734 5712 6.373774 CCTAGCATCTCCTTATAAAGCATTGG 59.626 42.308 0.00 0.00 0.00 3.16
2804 5782 3.388308 CTCTTATGGGCTTGATGTCTCG 58.612 50.000 0.00 0.00 0.00 4.04
2995 6009 4.597004 TCTCTTAACCCGTGAGAGTACAT 58.403 43.478 0.00 0.00 38.41 2.29
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 54 3.335579 ACCTTAAGAGGAACATCAACGC 58.664 45.455 3.36 0.00 46.74 4.84
116 123 7.549488 CCTCTAACCACGATTAATCAAGAACTT 59.451 37.037 15.57 1.82 0.00 2.66
343 374 3.513515 ACAAAGACAGAGAGAGGACCATC 59.486 47.826 0.00 0.00 0.00 3.51
825 3153 9.914131 GAAGAAATAAAAACTTCATTAGCAGGT 57.086 29.630 0.00 0.00 39.51 4.00
1095 3819 4.651778 AGTTGGGAAGATCACGATTTTGA 58.348 39.130 0.00 0.00 0.00 2.69
1613 4352 0.405585 AGCTTTAAGGGCTGCCAGAA 59.594 50.000 22.05 8.02 38.73 3.02
1816 4597 5.425577 TTCAAAGCTTGCGTTGTAATACA 57.574 34.783 17.66 0.00 0.00 2.29
1951 4795 8.606830 AGGACCAGTAAAGTAAGATTCATCTTT 58.393 33.333 7.36 0.39 44.28 2.52
2734 5712 5.758296 TGTCACTAACTTTCACAATCTCACC 59.242 40.000 0.00 0.00 0.00 4.02
2804 5782 6.257411 CACAGTGTTGAATCTCCTCATGATAC 59.743 42.308 0.00 0.00 0.00 2.24
2995 6009 1.298157 GCTGCTCCATTACGTGCACA 61.298 55.000 18.64 0.00 0.00 4.57
3581 6617 2.885616 TCTCTCCCTGTCCGTAAAAGT 58.114 47.619 0.00 0.00 0.00 2.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.