Multiple sequence alignment - TraesCS2D01G420600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G420600 chr2D 100.000 4000 0 0 1 4000 534496872 534500871 0.000000e+00 7387
1 TraesCS2D01G420600 chr1D 98.377 4005 47 6 1 4000 78402268 78398277 0.000000e+00 7020
2 TraesCS2D01G420600 chr3D 96.203 4030 119 13 1 4000 561011799 561015824 0.000000e+00 6564
3 TraesCS2D01G420600 chr5B 84.731 2659 310 66 456 3061 522093133 522090518 0.000000e+00 2573
4 TraesCS2D01G420600 chr5B 84.707 922 126 11 3088 3999 522090386 522089470 0.000000e+00 907
5 TraesCS2D01G420600 chr5B 82.151 465 51 17 1 433 522093591 522093127 1.760000e-98 370
6 TraesCS2D01G420600 chr2A 84.250 1981 193 67 31 1916 718349641 718351597 0.000000e+00 1820
7 TraesCS2D01G420600 chr2A 85.982 1120 123 28 1958 3061 718351606 718352707 0.000000e+00 1168
8 TraesCS2D01G420600 chr2A 85.993 921 117 10 3088 4000 718352845 718353761 0.000000e+00 976


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G420600 chr2D 534496872 534500871 3999 False 7387.000000 7387 100.000000 1 4000 1 chr2D.!!$F1 3999
1 TraesCS2D01G420600 chr1D 78398277 78402268 3991 True 7020.000000 7020 98.377000 1 4000 1 chr1D.!!$R1 3999
2 TraesCS2D01G420600 chr3D 561011799 561015824 4025 False 6564.000000 6564 96.203000 1 4000 1 chr3D.!!$F1 3999
3 TraesCS2D01G420600 chr5B 522089470 522093591 4121 True 1283.333333 2573 83.863000 1 3999 3 chr5B.!!$R1 3998
4 TraesCS2D01G420600 chr2A 718349641 718353761 4120 False 1321.333333 1820 85.408333 31 4000 3 chr2A.!!$F1 3969

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
769 897 0.951525 CGTTATGCCACACGTCCCAA 60.952 55.000 0.0 0.0 0.0 4.12 F
1240 1405 3.258372 TCATCTTCAAGTGCTAAGTCGGT 59.742 43.478 0.0 0.0 0.0 4.69 F
1702 1869 7.062605 CCAGATTGCATTTGTCATCTTTGTTAC 59.937 37.037 0.0 0.0 0.0 2.50 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2038 2206 0.976641 TGCCGAGATCAAGGTTGTCT 59.023 50.000 8.07 0.0 0.00 3.41 R
2579 2756 1.040646 TACTAGCATGGGCGAGGAAG 58.959 55.000 0.00 0.0 45.80 3.46 R
3389 3699 1.375396 CGGATCAGTTGCGAACCCA 60.375 57.895 0.00 0.0 42.53 4.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
99 100 2.166459 CCTTCTCAGATGGTTCGTGCTA 59.834 50.000 0.00 0.0 0.00 3.49
442 566 2.097629 TCAGCCTATTTGAGACGACGAG 59.902 50.000 0.00 0.0 0.00 4.18
769 897 0.951525 CGTTATGCCACACGTCCCAA 60.952 55.000 0.00 0.0 0.00 4.12
1132 1297 4.737946 GCAGGATGATAGTAGTTCGCAGTT 60.738 45.833 0.00 0.0 39.69 3.16
1240 1405 3.258372 TCATCTTCAAGTGCTAAGTCGGT 59.742 43.478 0.00 0.0 0.00 4.69
1702 1869 7.062605 CCAGATTGCATTTGTCATCTTTGTTAC 59.937 37.037 0.00 0.0 0.00 2.50
2579 2756 9.983804 GCTTGGTTATTTGTACACTACTTATTC 57.016 33.333 0.00 0.0 0.00 1.75
2949 3126 1.702401 TGTTTCCACCATCAGGCACTA 59.298 47.619 0.00 0.0 36.02 2.74
2997 3174 0.033366 GCCGGTGGCTCACAAAATTT 59.967 50.000 1.90 0.0 46.69 1.82
3289 3599 3.567164 CACTTCAAGTCTTGCCTCATGTT 59.433 43.478 7.78 0.0 0.00 2.71
3711 4027 2.486548 GGCTTATCCGCATTACTGGGAA 60.487 50.000 0.00 0.0 37.51 3.97
3725 4041 2.243221 ACTGGGAAGGCTATGCTTGATT 59.757 45.455 0.00 0.0 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
99 100 0.552367 TGGATCTGGGGTTGGATGGT 60.552 55.000 0.00 0.0 0.00 3.55
379 474 8.953313 ACCATTGGTTACACTAAAATAGTTAGC 58.047 33.333 1.37 0.0 31.00 3.09
442 566 0.746659 ACAACAGCTCAAAACCTGGC 59.253 50.000 0.00 0.0 33.43 4.85
1149 1314 2.523015 CTTAACATAACGAGCGTCCGT 58.477 47.619 0.00 0.0 45.64 4.69
1240 1405 1.357137 TGTTGGTGCAGGTGGATCTA 58.643 50.000 0.00 0.0 0.00 1.98
1702 1869 1.227556 GGTGCTAGTACATGGCCCG 60.228 63.158 13.26 0.0 33.66 6.13
1861 2028 4.104383 AGATTGGTGGACTGATTGTTGT 57.896 40.909 0.00 0.0 0.00 3.32
2038 2206 0.976641 TGCCGAGATCAAGGTTGTCT 59.023 50.000 8.07 0.0 0.00 3.41
2579 2756 1.040646 TACTAGCATGGGCGAGGAAG 58.959 55.000 0.00 0.0 45.80 3.46
2949 3126 6.806388 AAAACGTACCGATTTGGAATTAGT 57.194 33.333 0.00 0.0 42.00 2.24
2997 3174 6.849697 TCAGATAATTCTAGCCTTTTCCCCTA 59.150 38.462 0.00 0.0 0.00 3.53
3289 3599 2.168313 TCAGCATACATTTCAGCGAGGA 59.832 45.455 0.00 0.0 0.00 3.71
3389 3699 1.375396 CGGATCAGTTGCGAACCCA 60.375 57.895 0.00 0.0 42.53 4.51
3725 4041 1.227438 GGCGCGACCCAATTAGCTA 60.227 57.895 12.10 0.0 0.00 3.32
3799 4115 0.678048 GGCACTCCGAATTGGCTTCT 60.678 55.000 0.00 0.0 37.80 2.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.