Multiple sequence alignment - TraesCS2D01G399200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G399200 chr2D 100.000 2294 0 0 1 2294 512096960 512094667 0 4237
1 TraesCS2D01G399200 chr2D 97.187 1671 34 5 12 1678 155174913 155173252 0 2813
2 TraesCS2D01G399200 chr2D 95.275 1672 64 5 10 1678 651016883 651015224 0 2636
3 TraesCS2D01G399200 chr2D 96.774 620 19 1 1675 2294 651015194 651014576 0 1033
4 TraesCS2D01G399200 chr7D 97.020 1678 37 5 10 1678 80966886 80965213 0 2809
5 TraesCS2D01G399200 chr7D 96.728 1681 44 3 1 1678 68450267 68451939 0 2789
6 TraesCS2D01G399200 chr7D 96.347 1670 48 5 20 1678 166227734 166229401 0 2734
7 TraesCS2D01G399200 chr7D 95.756 1673 51 4 3 1672 536598319 536599974 0 2678
8 TraesCS2D01G399200 chr7D 97.581 620 14 1 1675 2294 6739822 6739204 0 1061
9 TraesCS2D01G399200 chr7D 97.097 620 18 0 1675 2294 80965183 80964564 0 1046
10 TraesCS2D01G399200 chr7D 96.629 623 21 0 1672 2294 68451968 68452590 0 1035
11 TraesCS2D01G399200 chr5D 96.175 1673 56 4 10 1678 440659073 440660741 0 2728
12 TraesCS2D01G399200 chr5D 97.258 620 17 0 1675 2294 468055347 468054728 0 1051
13 TraesCS2D01G399200 chr7B 94.967 1689 70 8 1 1678 105327993 105329677 0 2634
14 TraesCS2D01G399200 chr3B 94.709 1682 76 6 1 1678 660714595 660716267 0 2601
15 TraesCS2D01G399200 chr2A 82.308 2340 326 54 3 2294 95763968 95761669 0 1947
16 TraesCS2D01G399200 chr1D 96.774 620 20 0 1675 2294 398930744 398930125 0 1035
17 TraesCS2D01G399200 chr6D 96.613 620 21 0 1675 2294 114245873 114245254 0 1029
18 TraesCS2D01G399200 chr4D 96.469 623 22 0 1672 2294 455710525 455711147 0 1029


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G399200 chr2D 512094667 512096960 2293 True 4237.0 4237 100.0000 1 2294 1 chr2D.!!$R2 2293
1 TraesCS2D01G399200 chr2D 155173252 155174913 1661 True 2813.0 2813 97.1870 12 1678 1 chr2D.!!$R1 1666
2 TraesCS2D01G399200 chr2D 651014576 651016883 2307 True 1834.5 2636 96.0245 10 2294 2 chr2D.!!$R3 2284
3 TraesCS2D01G399200 chr7D 166227734 166229401 1667 False 2734.0 2734 96.3470 20 1678 1 chr7D.!!$F1 1658
4 TraesCS2D01G399200 chr7D 536598319 536599974 1655 False 2678.0 2678 95.7560 3 1672 1 chr7D.!!$F2 1669
5 TraesCS2D01G399200 chr7D 80964564 80966886 2322 True 1927.5 2809 97.0585 10 2294 2 chr7D.!!$R2 2284
6 TraesCS2D01G399200 chr7D 68450267 68452590 2323 False 1912.0 2789 96.6785 1 2294 2 chr7D.!!$F3 2293
7 TraesCS2D01G399200 chr7D 6739204 6739822 618 True 1061.0 1061 97.5810 1675 2294 1 chr7D.!!$R1 619
8 TraesCS2D01G399200 chr5D 440659073 440660741 1668 False 2728.0 2728 96.1750 10 1678 1 chr5D.!!$F1 1668
9 TraesCS2D01G399200 chr5D 468054728 468055347 619 True 1051.0 1051 97.2580 1675 2294 1 chr5D.!!$R1 619
10 TraesCS2D01G399200 chr7B 105327993 105329677 1684 False 2634.0 2634 94.9670 1 1678 1 chr7B.!!$F1 1677
11 TraesCS2D01G399200 chr3B 660714595 660716267 1672 False 2601.0 2601 94.7090 1 1678 1 chr3B.!!$F1 1677
12 TraesCS2D01G399200 chr2A 95761669 95763968 2299 True 1947.0 1947 82.3080 3 2294 1 chr2A.!!$R1 2291
13 TraesCS2D01G399200 chr1D 398930125 398930744 619 True 1035.0 1035 96.7740 1675 2294 1 chr1D.!!$R1 619
14 TraesCS2D01G399200 chr6D 114245254 114245873 619 True 1029.0 1029 96.6130 1675 2294 1 chr6D.!!$R1 619
15 TraesCS2D01G399200 chr4D 455710525 455711147 622 False 1029.0 1029 96.4690 1672 2294 1 chr4D.!!$F1 622

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
827 894 0.449388 CCACCTTTGAAGCGAGATGC 59.551 55.0 0.0 0.0 46.98 3.91 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1672 1745 0.539986 AGGGATTCGGTTGTATGCGT 59.46 50.0 0.0 0.0 0.0 5.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
39 40 1.344906 CCCCCTCTCAAATCCTCTCCT 60.345 57.143 0.00 0.00 0.00 3.69
301 318 5.013287 TGTTCTTATGTTGGTGCTAGGGTTA 59.987 40.000 0.00 0.00 0.00 2.85
302 319 5.353394 TCTTATGTTGGTGCTAGGGTTAG 57.647 43.478 0.00 0.00 0.00 2.34
303 320 4.163458 TCTTATGTTGGTGCTAGGGTTAGG 59.837 45.833 0.00 0.00 0.00 2.69
304 321 0.988832 TGTTGGTGCTAGGGTTAGGG 59.011 55.000 0.00 0.00 0.00 3.53
305 322 0.989602 GTTGGTGCTAGGGTTAGGGT 59.010 55.000 0.00 0.00 0.00 4.34
306 323 1.353358 GTTGGTGCTAGGGTTAGGGTT 59.647 52.381 0.00 0.00 0.00 4.11
713 780 4.397348 GGTGGCCGAATCACTTGT 57.603 55.556 0.00 0.00 35.61 3.16
827 894 0.449388 CCACCTTTGAAGCGAGATGC 59.551 55.000 0.00 0.00 46.98 3.91
1212 1284 6.115448 CAAGGTATATCTCTTGGGGTTAGG 57.885 45.833 9.06 0.00 37.35 2.69
1213 1285 4.168883 AGGTATATCTCTTGGGGTTAGGC 58.831 47.826 0.00 0.00 0.00 3.93
1487 1560 0.320683 CAAGTCACATGTGCCGAGGA 60.321 55.000 21.38 0.00 0.00 3.71
1843 1951 3.011760 GCGTGAGGGCTTTCGAACG 62.012 63.158 0.00 0.00 0.00 3.95
1859 1967 2.180159 AACGCTGTAGGCCGGTCATT 62.180 55.000 9.71 0.00 37.74 2.57
2061 2169 3.812156 TTTGTGTCATATCGGATCGGT 57.188 42.857 0.00 0.00 0.00 4.69
2100 2208 1.065491 CGGTGGAGATTGACATTCCCA 60.065 52.381 4.42 4.42 0.00 4.37
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
301 318 3.181380 ACCCTAACCCTAAACCTAACCCT 60.181 47.826 0.00 0.00 0.00 4.34
302 319 3.192944 ACCCTAACCCTAAACCTAACCC 58.807 50.000 0.00 0.00 0.00 4.11
303 320 4.043310 ACAACCCTAACCCTAAACCTAACC 59.957 45.833 0.00 0.00 0.00 2.85
304 321 5.246981 ACAACCCTAACCCTAAACCTAAC 57.753 43.478 0.00 0.00 0.00 2.34
305 322 5.134169 ACAACAACCCTAACCCTAAACCTAA 59.866 40.000 0.00 0.00 0.00 2.69
306 323 4.664536 ACAACAACCCTAACCCTAAACCTA 59.335 41.667 0.00 0.00 0.00 3.08
346 411 6.072397 CCAAGGATTAACACGGAATACAAACA 60.072 38.462 0.00 0.00 0.00 2.83
711 778 4.216257 GCAAATAACTCAAGAGCCTTGACA 59.784 41.667 12.03 3.71 0.00 3.58
713 780 4.397420 TGCAAATAACTCAAGAGCCTTGA 58.603 39.130 14.43 14.43 0.00 3.02
827 894 5.049828 GGGTCAAAAGAGGTTCAACAATTG 58.950 41.667 3.24 3.24 0.00 2.32
1213 1285 2.842394 ATCACGGTGAGAGCTTGGCG 62.842 60.000 16.84 0.00 0.00 5.69
1487 1560 2.397044 TCTTGCCATCCACCCTTTTT 57.603 45.000 0.00 0.00 0.00 1.94
1672 1745 0.539986 AGGGATTCGGTTGTATGCGT 59.460 50.000 0.00 0.00 0.00 5.24
1729 1837 2.100631 GGCTCGACCACATGAACCG 61.101 63.158 0.00 0.00 38.86 4.44
1843 1951 2.472909 GCAATGACCGGCCTACAGC 61.473 63.158 0.00 0.00 42.60 4.40
2061 2169 3.133362 ACCGCGTTAAGAATTCCTGGATA 59.867 43.478 4.92 0.00 0.00 2.59
2240 2348 3.699779 TTGTGTGCGAGCAATTTGTTA 57.300 38.095 0.00 0.00 0.00 2.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.