Multiple sequence alignment - TraesCS2D01G391300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G391300 chr2D 100.000 2549 0 0 1 2549 498472230 498469682 0.000000e+00 4708
1 TraesCS2D01G391300 chr2D 95.531 1969 51 11 587 2549 547242743 547240806 0.000000e+00 3114
2 TraesCS2D01G391300 chr2D 94.134 358 19 1 585 942 16065484 16065839 6.200000e-151 544
3 TraesCS2D01G391300 chr2D 94.118 357 14 2 587 939 435209599 435209952 1.040000e-148 536
4 TraesCS2D01G391300 chr6D 96.722 1983 44 6 585 2549 109963210 109965189 0.000000e+00 3282
5 TraesCS2D01G391300 chr5D 96.520 1983 46 7 586 2549 336262623 336264601 0.000000e+00 3258
6 TraesCS2D01G391300 chr1D 96.266 1982 56 4 584 2549 26486135 26488114 0.000000e+00 3234
7 TraesCS2D01G391300 chr6A 95.381 1970 81 7 587 2549 57901159 57903125 0.000000e+00 3125
8 TraesCS2D01G391300 chr6A 94.985 1974 88 8 585 2549 203520914 203518943 0.000000e+00 3086
9 TraesCS2D01G391300 chr2A 95.023 1969 88 8 587 2549 233255261 233257225 0.000000e+00 3085
10 TraesCS2D01G391300 chr2A 94.769 1969 95 7 587 2549 611725136 611723170 0.000000e+00 3059
11 TraesCS2D01G391300 chr2A 94.654 1964 94 6 586 2543 674415063 674413105 0.000000e+00 3035
12 TraesCS2D01G391300 chr2A 94.369 586 28 3 1 586 643166886 643166306 0.000000e+00 894
13 TraesCS2D01G391300 chr2B 98.805 586 7 0 1 586 585711619 585711034 0.000000e+00 1044
14 TraesCS2D01G391300 chr3A 92.562 363 26 1 580 941 164803407 164803045 1.050000e-143 520


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G391300 chr2D 498469682 498472230 2548 True 4708 4708 100.000 1 2549 1 chr2D.!!$R1 2548
1 TraesCS2D01G391300 chr2D 547240806 547242743 1937 True 3114 3114 95.531 587 2549 1 chr2D.!!$R2 1962
2 TraesCS2D01G391300 chr6D 109963210 109965189 1979 False 3282 3282 96.722 585 2549 1 chr6D.!!$F1 1964
3 TraesCS2D01G391300 chr5D 336262623 336264601 1978 False 3258 3258 96.520 586 2549 1 chr5D.!!$F1 1963
4 TraesCS2D01G391300 chr1D 26486135 26488114 1979 False 3234 3234 96.266 584 2549 1 chr1D.!!$F1 1965
5 TraesCS2D01G391300 chr6A 57901159 57903125 1966 False 3125 3125 95.381 587 2549 1 chr6A.!!$F1 1962
6 TraesCS2D01G391300 chr6A 203518943 203520914 1971 True 3086 3086 94.985 585 2549 1 chr6A.!!$R1 1964
7 TraesCS2D01G391300 chr2A 233255261 233257225 1964 False 3085 3085 95.023 587 2549 1 chr2A.!!$F1 1962
8 TraesCS2D01G391300 chr2A 611723170 611725136 1966 True 3059 3059 94.769 587 2549 1 chr2A.!!$R1 1962
9 TraesCS2D01G391300 chr2A 674413105 674415063 1958 True 3035 3035 94.654 586 2543 1 chr2A.!!$R3 1957
10 TraesCS2D01G391300 chr2A 643166306 643166886 580 True 894 894 94.369 1 586 1 chr2A.!!$R2 585
11 TraesCS2D01G391300 chr2B 585711034 585711619 585 True 1044 1044 98.805 1 586 1 chr2B.!!$R1 585

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
808 809 2.197324 GTGGCTTGTGGGACCCAA 59.803 61.111 16.98 0.0 34.18 4.12 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2182 2218 1.251527 AAACACCACAAACCCACGCA 61.252 50.0 0.0 0.0 0.0 5.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
189 190 7.896811 TCACAGTGAGTAATAATGCTATAGGG 58.103 38.462 0.00 0.0 0.00 3.53
383 384 6.378564 TCACAAAAAGGTGTACCAAAATCAGA 59.621 34.615 3.56 0.0 39.76 3.27
420 421 7.990314 TCAGTTACATAGCATATAAACCAGCAA 59.010 33.333 0.00 0.0 0.00 3.91
644 645 2.787994 CTCAGTTTTGCCCTCAGATGT 58.212 47.619 0.00 0.0 0.00 3.06
808 809 2.197324 GTGGCTTGTGGGACCCAA 59.803 61.111 16.98 0.0 34.18 4.12
1431 1454 5.470098 TGTTGAGCTTAGGATGTTGAAGAAC 59.530 40.000 0.00 0.0 0.00 3.01
2182 2218 1.609794 GGGACTCGAACCCAGGACT 60.610 63.158 18.78 0.0 46.05 3.85
2375 2415 4.719273 ACTGAAATTTTGGAGGGTTGGAAA 59.281 37.500 0.00 0.0 0.00 3.13
2424 2465 5.018809 ACATGATTTTGGTTAGAGTGGCAT 58.981 37.500 0.00 0.0 0.00 4.40
2533 2624 3.003763 GCTTCTCACCCCCTCCGT 61.004 66.667 0.00 0.0 0.00 4.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
189 190 2.798976 TGGAAGTGTTCATGCTTTGC 57.201 45.000 0.00 0.0 0.00 3.68
644 645 2.224018 GGGCAAAACTGAGCACAATTCA 60.224 45.455 0.00 0.0 33.42 2.57
808 809 2.345244 CCTGCAACGGCTCTCTGT 59.655 61.111 0.00 0.0 41.91 3.41
864 880 4.056125 CCGCCGTGCTCTCTGTCA 62.056 66.667 0.00 0.0 0.00 3.58
1431 1454 5.248640 TGATCTTCAAGCTTCCTAACCTTG 58.751 41.667 0.00 0.0 37.80 3.61
1675 1703 8.703378 AGTTTCTGAATTCCTCATTTCTTCTT 57.297 30.769 2.27 0.0 32.14 2.52
1929 1959 3.080300 ACCATAATTGTTTGGCTCCGA 57.920 42.857 4.36 0.0 36.41 4.55
2182 2218 1.251527 AAACACCACAAACCCACGCA 61.252 50.000 0.00 0.0 0.00 5.24
2294 2330 6.128391 GCAAACATTCACGGTCTCACTATTTA 60.128 38.462 0.00 0.0 0.00 1.40
2375 2415 5.051106 GCAATGCAAACATACGTTTTCAACT 60.051 36.000 0.00 0.0 42.82 3.16
2396 2437 4.832266 ACTCTAACCAAAATCATGTGGCAA 59.168 37.500 0.10 0.0 38.58 4.52
2424 2465 5.131475 AGTGTCACTCTAACCCTAAACCAAA 59.869 40.000 0.00 0.0 0.00 3.28
2501 2592 4.213564 GAGAAGCCCTCTCTTTCATTCA 57.786 45.455 6.23 0.0 46.32 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.