Multiple sequence alignment - TraesCS2D01G389300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G389300 chr2D 100.000 2642 0 0 1 2642 495840740 495838099 0.000000e+00 4879
1 TraesCS2D01G389300 chr2D 93.491 1644 82 13 816 2454 632659489 632657866 0.000000e+00 2420
2 TraesCS2D01G389300 chr2D 92.574 202 14 1 2429 2629 547944925 547945126 3.330000e-74 289
3 TraesCS2D01G389300 chr3D 97.268 2635 66 5 1 2632 571897977 571900608 0.000000e+00 4462
4 TraesCS2D01G389300 chr3D 84.108 409 60 4 1991 2397 17127864 17127459 8.870000e-105 390
5 TraesCS2D01G389300 chr3D 92.453 212 13 3 2429 2637 338936689 338936478 1.540000e-77 300
6 TraesCS2D01G389300 chr1D 96.751 2370 49 5 1 2344 463973882 463971515 0.000000e+00 3925
7 TraesCS2D01G389300 chr1D 95.562 338 15 0 2291 2628 463971533 463971196 2.310000e-150 542
8 TraesCS2D01G389300 chr3B 94.467 2458 112 11 1 2454 670157052 670154615 0.000000e+00 3764
9 TraesCS2D01G389300 chr3B 97.516 1973 47 2 3 1974 721033610 721035581 0.000000e+00 3371
10 TraesCS2D01G389300 chr3B 96.959 1973 59 1 3 1974 688291127 688293099 0.000000e+00 3310
11 TraesCS2D01G389300 chr3B 96.861 1975 59 2 3 1974 688231451 688233425 0.000000e+00 3301
12 TraesCS2D01G389300 chr3B 90.701 656 37 6 1979 2629 688233466 688234102 0.000000e+00 852
13 TraesCS2D01G389300 chr3B 90.701 656 38 5 1979 2629 688293140 688293777 0.000000e+00 852
14 TraesCS2D01G389300 chr3B 90.772 596 31 8 2038 2628 721035581 721036157 0.000000e+00 774
15 TraesCS2D01G389300 chr7D 94.420 2294 102 11 143 2434 22987851 22985582 0.000000e+00 3504
16 TraesCS2D01G389300 chr7D 92.788 208 13 2 2429 2635 22985500 22985294 1.540000e-77 300
17 TraesCS2D01G389300 chr4D 92.131 2440 178 9 1 2434 80462590 80465021 0.000000e+00 3430
18 TraesCS2D01G389300 chr7B 88.073 2423 241 36 1 2408 713205295 713202906 0.000000e+00 2830
19 TraesCS2D01G389300 chr7B 83.130 409 64 4 1991 2397 241111338 241110933 4.150000e-98 368
20 TraesCS2D01G389300 chr5A 93.201 1662 82 16 798 2454 706448861 706447226 0.000000e+00 2414
21 TraesCS2D01G389300 chr6A 93.408 1608 75 18 854 2454 608546130 608547713 0.000000e+00 2353
22 TraesCS2D01G389300 chr2B 89.596 1461 105 21 998 2454 760251478 760252895 0.000000e+00 1812
23 TraesCS2D01G389300 chrUn 92.308 208 14 2 2429 2635 89944999 89944793 7.150000e-76 294


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G389300 chr2D 495838099 495840740 2641 True 4879.0 4879 100.0000 1 2642 1 chr2D.!!$R1 2641
1 TraesCS2D01G389300 chr2D 632657866 632659489 1623 True 2420.0 2420 93.4910 816 2454 1 chr2D.!!$R2 1638
2 TraesCS2D01G389300 chr3D 571897977 571900608 2631 False 4462.0 4462 97.2680 1 2632 1 chr3D.!!$F1 2631
3 TraesCS2D01G389300 chr1D 463971196 463973882 2686 True 2233.5 3925 96.1565 1 2628 2 chr1D.!!$R1 2627
4 TraesCS2D01G389300 chr3B 670154615 670157052 2437 True 3764.0 3764 94.4670 1 2454 1 chr3B.!!$R1 2453
5 TraesCS2D01G389300 chr3B 688291127 688293777 2650 False 2081.0 3310 93.8300 3 2629 2 chr3B.!!$F2 2626
6 TraesCS2D01G389300 chr3B 688231451 688234102 2651 False 2076.5 3301 93.7810 3 2629 2 chr3B.!!$F1 2626
7 TraesCS2D01G389300 chr3B 721033610 721036157 2547 False 2072.5 3371 94.1440 3 2628 2 chr3B.!!$F3 2625
8 TraesCS2D01G389300 chr7D 22985294 22987851 2557 True 1902.0 3504 93.6040 143 2635 2 chr7D.!!$R1 2492
9 TraesCS2D01G389300 chr4D 80462590 80465021 2431 False 3430.0 3430 92.1310 1 2434 1 chr4D.!!$F1 2433
10 TraesCS2D01G389300 chr7B 713202906 713205295 2389 True 2830.0 2830 88.0730 1 2408 1 chr7B.!!$R2 2407
11 TraesCS2D01G389300 chr5A 706447226 706448861 1635 True 2414.0 2414 93.2010 798 2454 1 chr5A.!!$R1 1656
12 TraesCS2D01G389300 chr6A 608546130 608547713 1583 False 2353.0 2353 93.4080 854 2454 1 chr6A.!!$F1 1600
13 TraesCS2D01G389300 chr2B 760251478 760252895 1417 False 1812.0 1812 89.5960 998 2454 1 chr2B.!!$F1 1456

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
849 856 1.176527 GCTTTGTCAGGGCTTATGCA 58.823 50.0 2.72 0.0 41.91 3.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2299 2410 1.49496 AACCACAGCCAAACCATTGT 58.505 45.0 0.0 0.0 34.6 2.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
96 97 2.771943 CCCTAGCATACAGGTTCCTTCA 59.228 50.000 0.00 0.0 0.00 3.02
159 166 2.622942 GAGACTTGCAAAATCACCACCA 59.377 45.455 11.79 0.0 0.00 4.17
684 691 6.914665 AGGATTTCCATGAATGATTAGGTCA 58.085 36.000 0.00 0.0 38.91 4.02
849 856 1.176527 GCTTTGTCAGGGCTTATGCA 58.823 50.000 2.72 0.0 41.91 3.96
944 952 2.107950 TGGCTTAGATTTGACACGGG 57.892 50.000 0.00 0.0 0.00 5.28
1266 1275 2.817844 CGGTATCCCATGTCGTCATCTA 59.182 50.000 0.00 0.0 31.15 1.98
1285 1294 7.987458 GTCATCTAATCCATGTCCTAAGAACAA 59.013 37.037 0.00 0.0 0.00 2.83
1764 1775 5.844004 ACATGATTACGGTACATTCCTCTC 58.156 41.667 0.00 0.0 0.00 3.20
2130 2208 9.952188 GCTATCACTATTAATGATGCGTCTATA 57.048 33.333 7.58 0.0 37.38 1.31
2141 2219 7.875316 ATGATGCGTCTATATTGTAAGTGTC 57.125 36.000 7.58 0.0 0.00 3.67
2299 2410 1.699083 TGCATGAGTCCTTGAACTGGA 59.301 47.619 0.00 0.0 0.00 3.86
2361 2524 9.620660 CAATGGTTTAAGTTGTTCTATTGTACC 57.379 33.333 0.00 0.0 0.00 3.34
2400 2563 1.729586 ACAAGGAACTGGGCAGACTA 58.270 50.000 0.00 0.0 40.86 2.59
2401 2564 2.054799 ACAAGGAACTGGGCAGACTAA 58.945 47.619 0.00 0.0 40.86 2.24
2492 2743 5.944007 GGGGTTATGTGTAGAACAACTTCAT 59.056 40.000 0.00 0.0 43.61 2.57
2632 2883 4.920640 TCACCCGATATTGTCTCTTCTC 57.079 45.455 0.00 0.0 0.00 2.87
2634 2885 4.709886 TCACCCGATATTGTCTCTTCTCAA 59.290 41.667 0.00 0.0 0.00 3.02
2635 2886 5.186992 TCACCCGATATTGTCTCTTCTCAAA 59.813 40.000 0.00 0.0 0.00 2.69
2636 2887 6.051717 CACCCGATATTGTCTCTTCTCAAAT 58.948 40.000 0.00 0.0 0.00 2.32
2637 2888 7.069455 TCACCCGATATTGTCTCTTCTCAAATA 59.931 37.037 0.00 0.0 0.00 1.40
2638 2889 7.875041 CACCCGATATTGTCTCTTCTCAAATAT 59.125 37.037 0.00 0.0 0.00 1.28
2639 2890 8.432805 ACCCGATATTGTCTCTTCTCAAATATT 58.567 33.333 0.00 0.0 0.00 1.28
2640 2891 8.930760 CCCGATATTGTCTCTTCTCAAATATTC 58.069 37.037 0.00 0.0 0.00 1.75
2641 2892 8.930760 CCGATATTGTCTCTTCTCAAATATTCC 58.069 37.037 0.00 0.0 0.00 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
159 166 3.806949 TGATGAGGCACCTAAGGTTTT 57.193 42.857 0.00 0.00 31.02 2.43
553 560 6.295292 GGAAAACTTCCCTTATTGCATTGTCT 60.295 38.462 0.00 0.00 44.30 3.41
581 588 1.541889 GCATAGCCTATGTGCAGCTGA 60.542 52.381 20.43 0.00 44.85 4.26
684 691 3.055094 AGTTTCAGAAGACCACACACACT 60.055 43.478 0.00 0.00 0.00 3.55
944 952 5.237779 TCCTTATGACGTTGTTCTTCCAAAC 59.762 40.000 0.00 0.00 0.00 2.93
1266 1275 4.044065 TGGGTTGTTCTTAGGACATGGATT 59.956 41.667 0.00 0.00 0.00 3.01
1285 1294 4.650972 TTGGTAGTTCATTTAGCTGGGT 57.349 40.909 0.00 0.00 0.00 4.51
1569 1579 9.208022 CAACCTAAAAATTCCTCAAATTCTTCC 57.792 33.333 0.00 0.00 36.54 3.46
2130 2208 5.186021 CCTCACTCCAGTAGACACTTACAAT 59.814 44.000 0.00 0.00 30.46 2.71
2141 2219 5.069648 TCAAGATAATGCCTCACTCCAGTAG 59.930 44.000 0.00 0.00 0.00 2.57
2206 2309 8.755977 ACTTAAGTAAGGCAAATAGTACAGCTA 58.244 33.333 6.26 0.00 37.62 3.32
2299 2410 1.494960 AACCACAGCCAAACCATTGT 58.505 45.000 0.00 0.00 34.60 2.71
2400 2563 6.298361 ACAAAGCTCTGGCCAAAAATATTTT 58.702 32.000 7.01 7.64 39.73 1.82
2401 2564 5.868454 ACAAAGCTCTGGCCAAAAATATTT 58.132 33.333 7.01 0.52 39.73 1.40
2492 2743 2.041819 AAAAACGCCCACCCCCAA 60.042 55.556 0.00 0.00 0.00 4.12


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.