Multiple sequence alignment - TraesCS2D01G386500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G386500 chr2D 100.000 3238 0 0 1 3238 491798571 491801808 0.000000e+00 5980
1 TraesCS2D01G386500 chr2D 100.000 82 0 0 3650 3731 491802220 491802301 6.450000e-33 152
2 TraesCS2D01G386500 chr2B 96.920 3182 58 7 12 3182 576081001 576084153 0.000000e+00 5297
3 TraesCS2D01G386500 chr2B 100.000 82 0 0 3650 3731 576084772 576084853 6.450000e-33 152
4 TraesCS2D01G386500 chr2A 98.373 2581 29 4 647 3224 636900926 636903496 0.000000e+00 4521
5 TraesCS2D01G386500 chr2A 95.238 588 28 0 1 588 636900068 636900655 0.000000e+00 931
6 TraesCS2D01G386500 chr2A 100.000 82 0 0 3650 3731 636904038 636904119 6.450000e-33 152


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G386500 chr2D 491798571 491802301 3730 False 3066.0 5980 100.000000 1 3731 2 chr2D.!!$F1 3730
1 TraesCS2D01G386500 chr2B 576081001 576084853 3852 False 2724.5 5297 98.460000 12 3731 2 chr2B.!!$F1 3719
2 TraesCS2D01G386500 chr2A 636900068 636904119 4051 False 1868.0 4521 97.870333 1 3731 3 chr2A.!!$F1 3730

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
459 460 0.179150 TTTGCCCAAATATCGCACGC 60.179 50.000 0.0 0.0 30.84 5.34 F
795 1008 1.070445 CCTGGACCCATGAGATCGC 59.930 63.158 0.0 0.0 0.00 4.58 F
1888 2101 1.153628 GCGCCACTATCGACAGGTT 60.154 57.895 0.0 0.0 0.00 3.50 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1720 1933 4.937620 CGAAGGATCAGACAATCCAAAGAA 59.062 41.667 5.76 0.00 46.56 2.52 R
2547 2760 4.967442 TCTTCATCAGAATCCAGTGGAGAT 59.033 41.667 18.69 11.62 34.05 2.75 R
2906 3122 0.031111 TCTACCATGTGGAGGAGGGG 60.031 60.000 5.96 0.00 38.94 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 30 1.502163 CGCTGCTGTGCCTTATAGCC 61.502 60.000 0.00 0.00 42.32 3.93
95 96 2.731461 CCCTCCCCCATCCTCTCCT 61.731 68.421 0.00 0.00 0.00 3.69
101 102 1.764054 CCCATCCTCTCCTCCGCTT 60.764 63.158 0.00 0.00 0.00 4.68
459 460 0.179150 TTTGCCCAAATATCGCACGC 60.179 50.000 0.00 0.00 30.84 5.34
795 1008 1.070445 CCTGGACCCATGAGATCGC 59.930 63.158 0.00 0.00 0.00 4.58
1088 1301 7.014711 CAGGATCTATGGTAAGCTTCTGAAGTA 59.985 40.741 17.97 1.83 0.00 2.24
1297 1510 3.693807 TGCAGAATCTCAATTTCTGGCT 58.306 40.909 13.54 0.00 46.55 4.75
1609 1822 3.721868 CGTGAGGCCCCTAAAGGA 58.278 61.111 0.00 0.00 38.24 3.36
1888 2101 1.153628 GCGCCACTATCGACAGGTT 60.154 57.895 0.00 0.00 0.00 3.50
2209 2422 2.092538 AGCAGAGGTAAGAGCAATGCAT 60.093 45.455 8.35 0.00 33.59 3.96
2906 3122 2.266554 CTCAGCGAACACTTCATCTCC 58.733 52.381 0.00 0.00 0.00 3.71
2907 3123 1.066858 TCAGCGAACACTTCATCTCCC 60.067 52.381 0.00 0.00 0.00 4.30
2908 3124 0.250513 AGCGAACACTTCATCTCCCC 59.749 55.000 0.00 0.00 0.00 4.81
2928 3144 1.974236 CCTCCTCCACATGGTAGATCC 59.026 57.143 0.00 0.00 36.34 3.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
4 5 1.903877 AAGGCACAGCAGCGGTAGAT 61.904 55.000 0.00 0.00 34.64 1.98
75 76 3.795924 AGAGGATGGGGGAGGGGG 61.796 72.222 0.00 0.00 0.00 5.40
423 424 1.001487 CAAAAGCGCAAGATGTGGACA 60.001 47.619 11.47 0.00 43.02 4.02
459 460 0.248907 ACGTAGATGCATCGTTCGGG 60.249 55.000 29.04 17.64 34.07 5.14
607 608 7.333528 TGCAAATTATAACAGTCCCAGAATC 57.666 36.000 0.00 0.00 0.00 2.52
687 900 5.645067 TCGAGTCGGATAAAACTTCTCTACA 59.355 40.000 13.54 0.00 0.00 2.74
699 912 0.752009 AGCCTGCTCGAGTCGGATAA 60.752 55.000 21.44 0.00 0.00 1.75
795 1008 5.812127 TGACACTTTAACAGATGATCCATCG 59.188 40.000 0.00 0.00 44.67 3.84
1108 1321 9.426837 CAATAAAACAAATGAGGTGATCAATGT 57.573 29.630 0.00 0.00 42.53 2.71
1109 1322 9.642327 TCAATAAAACAAATGAGGTGATCAATG 57.358 29.630 0.00 0.00 42.53 2.82
1166 1379 7.609960 TCAAAAACTGCAATATGGCATAAGAA 58.390 30.769 11.86 1.14 43.97 2.52
1297 1510 9.094578 CTCTTATCCCCATCTCTGAAGTTAATA 57.905 37.037 0.00 0.00 0.00 0.98
1609 1822 5.749462 AGTGCAGAAAATAGCTGTAGGAAT 58.251 37.500 0.00 0.00 35.81 3.01
1720 1933 4.937620 CGAAGGATCAGACAATCCAAAGAA 59.062 41.667 5.76 0.00 46.56 2.52
2209 2422 7.048629 TGCCTGAAAAATTCAAATGAGTACA 57.951 32.000 0.00 0.00 39.58 2.90
2547 2760 4.967442 TCTTCATCAGAATCCAGTGGAGAT 59.033 41.667 18.69 11.62 34.05 2.75
2906 3122 0.031111 TCTACCATGTGGAGGAGGGG 60.031 60.000 5.96 0.00 38.94 4.79
2907 3123 1.974236 GATCTACCATGTGGAGGAGGG 59.026 57.143 5.96 0.00 38.94 4.30
2908 3124 1.974236 GGATCTACCATGTGGAGGAGG 59.026 57.143 5.96 0.00 38.94 4.30
2928 3144 2.023673 TGTTCAGTTGAAAGGCCACAG 58.976 47.619 5.01 0.00 35.58 3.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.