Multiple sequence alignment - TraesCS2D01G385400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G385400 chr2D 100.000 2498 0 0 1 2498 489934709 489932212 0.000000e+00 4614.0
1 TraesCS2D01G385400 chr2D 98.319 2499 41 1 1 2498 547545912 547543414 0.000000e+00 4381.0
2 TraesCS2D01G385400 chr2D 98.122 2503 28 7 1 2498 624287353 624289841 0.000000e+00 4344.0
3 TraesCS2D01G385400 chr2D 93.217 2344 102 29 1 2301 568357574 568355245 0.000000e+00 3395.0
4 TraesCS2D01G385400 chr5D 98.679 2499 31 2 1 2498 545533329 545535826 0.000000e+00 4431.0
5 TraesCS2D01G385400 chr5D 93.077 2369 111 30 1 2337 494245267 494242920 0.000000e+00 3417.0
6 TraesCS2D01G385400 chr5D 96.067 1729 54 8 782 2498 408554332 408552606 0.000000e+00 2804.0
7 TraesCS2D01G385400 chr5D 96.364 55 2 0 1 55 545540162 545540108 9.510000e-15 91.6
8 TraesCS2D01G385400 chr1D 97.721 2501 38 5 1 2498 444898550 444901034 0.000000e+00 4285.0
9 TraesCS2D01G385400 chr7D 97.321 2501 48 5 1 2498 625182014 625179530 0.000000e+00 4229.0
10 TraesCS2D01G385400 chr7D 96.997 1765 47 6 1 1762 393113683 393111922 0.000000e+00 2961.0
11 TraesCS2D01G385400 chrUn 95.863 2514 46 11 1 2498 70158408 70155937 0.000000e+00 4013.0
12 TraesCS2D01G385400 chr3D 96.671 1712 36 3 802 2498 19765755 19764050 0.000000e+00 2826.0
13 TraesCS2D01G385400 chr3D 95.600 750 16 3 1 749 19766487 19765754 0.000000e+00 1186.0
14 TraesCS2D01G385400 chr2B 91.438 1460 76 13 883 2334 69352997 69354415 0.000000e+00 1958.0
15 TraesCS2D01G385400 chr6D 96.837 664 10 2 1 664 137509996 137509344 0.000000e+00 1099.0
16 TraesCS2D01G385400 chr6D 97.071 239 7 0 2260 2498 137509349 137509111 1.080000e-108 403.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G385400 chr2D 489932212 489934709 2497 True 4614 4614 100.0000 1 2498 1 chr2D.!!$R1 2497
1 TraesCS2D01G385400 chr2D 547543414 547545912 2498 True 4381 4381 98.3190 1 2498 1 chr2D.!!$R2 2497
2 TraesCS2D01G385400 chr2D 624287353 624289841 2488 False 4344 4344 98.1220 1 2498 1 chr2D.!!$F1 2497
3 TraesCS2D01G385400 chr2D 568355245 568357574 2329 True 3395 3395 93.2170 1 2301 1 chr2D.!!$R3 2300
4 TraesCS2D01G385400 chr5D 545533329 545535826 2497 False 4431 4431 98.6790 1 2498 1 chr5D.!!$F1 2497
5 TraesCS2D01G385400 chr5D 494242920 494245267 2347 True 3417 3417 93.0770 1 2337 1 chr5D.!!$R2 2336
6 TraesCS2D01G385400 chr5D 408552606 408554332 1726 True 2804 2804 96.0670 782 2498 1 chr5D.!!$R1 1716
7 TraesCS2D01G385400 chr1D 444898550 444901034 2484 False 4285 4285 97.7210 1 2498 1 chr1D.!!$F1 2497
8 TraesCS2D01G385400 chr7D 625179530 625182014 2484 True 4229 4229 97.3210 1 2498 1 chr7D.!!$R2 2497
9 TraesCS2D01G385400 chr7D 393111922 393113683 1761 True 2961 2961 96.9970 1 1762 1 chr7D.!!$R1 1761
10 TraesCS2D01G385400 chrUn 70155937 70158408 2471 True 4013 4013 95.8630 1 2498 1 chrUn.!!$R1 2497
11 TraesCS2D01G385400 chr3D 19764050 19766487 2437 True 2006 2826 96.1355 1 2498 2 chr3D.!!$R1 2497
12 TraesCS2D01G385400 chr2B 69352997 69354415 1418 False 1958 1958 91.4380 883 2334 1 chr2B.!!$F1 1451
13 TraesCS2D01G385400 chr6D 137509111 137509996 885 True 751 1099 96.9540 1 2498 2 chr6D.!!$R1 2497

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
107 129 2.575993 CTCACTCACTCCCCTGCG 59.424 66.667 0.0 0.0 0.00 5.18 F
620 689 2.804986 TGCTCATCCCAAGTGCATTA 57.195 45.000 0.0 0.0 31.36 1.90 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1292 1365 2.031333 CACCTCTGCTCTTTTGCAAGTC 60.031 50.000 0.0 0.0 42.83 3.01 R
2264 2362 1.962807 TCGAAGAAACGGACCCACTTA 59.037 47.619 0.0 0.0 0.00 2.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
107 129 2.575993 CTCACTCACTCCCCTGCG 59.424 66.667 0.00 0.00 0.00 5.18
620 689 2.804986 TGCTCATCCCAAGTGCATTA 57.195 45.000 0.00 0.00 31.36 1.90
1250 1323 3.971245 TGAGAAGAAGAAGAAGGAGCC 57.029 47.619 0.00 0.00 0.00 4.70
1292 1365 1.471684 GGTGCAGATGGAAAAGCTCAG 59.528 52.381 0.00 0.00 0.00 3.35
1658 1733 9.575868 TTCCTATGTTGTTAAGTTGTAATGGAA 57.424 29.630 0.00 0.00 0.00 3.53
1876 1951 1.707989 TGACCAAATGCAACCCTAGGA 59.292 47.619 11.48 0.00 0.00 2.94
2126 2224 1.301479 GGAGTTCAACCGCCGACTT 60.301 57.895 0.00 0.00 0.00 3.01
2191 2289 0.467290 GTTTTCACTGGTGGCAGGGA 60.467 55.000 0.70 0.00 31.89 4.20
2264 2362 0.835941 CTCATCCAGCAACTAGGGCT 59.164 55.000 5.43 5.43 43.77 5.19
2467 2578 9.098355 GCTACTGTCAATGAAATTATGTAGTGA 57.902 33.333 0.00 0.00 32.46 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
107 129 4.219999 GAGCAGGGGAGAGAGCGC 62.220 72.222 0.00 0.00 0.00 5.92
186 231 2.639327 GCATGGCGGCAAGGAAGTT 61.639 57.895 18.31 0.00 0.00 2.66
620 689 3.589951 AATAGGCCTCAGTTGATGCAT 57.410 42.857 9.68 0.00 37.41 3.96
1250 1323 4.440880 CTCCAACATAGCTTTCTCCTCTG 58.559 47.826 0.00 0.00 0.00 3.35
1292 1365 2.031333 CACCTCTGCTCTTTTGCAAGTC 60.031 50.000 0.00 0.00 42.83 3.01
1658 1733 9.109393 CATTACAACACTTAATAGCATAGGTGT 57.891 33.333 6.36 6.36 44.88 4.16
1876 1951 2.579400 GGATGGGGTTGGGTTTAGTAGT 59.421 50.000 0.00 0.00 0.00 2.73
2126 2224 4.942483 CACTTCTCTAGTACCTTCTCGGAA 59.058 45.833 0.00 0.00 34.56 4.30
2191 2289 7.002879 CCTAATGATCTCCATGAATGACCTTT 58.997 38.462 0.00 0.00 35.24 3.11
2264 2362 1.962807 TCGAAGAAACGGACCCACTTA 59.037 47.619 0.00 0.00 0.00 2.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.