Multiple sequence alignment - TraesCS2D01G383000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G383000 chr2D 100.000 2276 0 0 1 2276 487337164 487334889 0 4204
1 TraesCS2D01G383000 chr2D 98.802 1002 11 1 1276 2276 487327527 487326526 0 1783
2 TraesCS2D01G383000 chr2D 98.703 1002 12 1 1276 2276 379656971 379655970 0 1777
3 TraesCS2D01G383000 chr6D 94.737 1273 65 1 1 1273 450905959 450907229 0 1978
4 TraesCS2D01G383000 chr6D 98.902 1002 10 1 1276 2276 53163860 53164861 0 1788
5 TraesCS2D01G383000 chr3D 94.614 1281 60 3 1 1273 449746631 449747910 0 1975
6 TraesCS2D01G383000 chr3D 94.366 1278 66 4 1 1273 593766351 593765075 0 1956
7 TraesCS2D01G383000 chr4B 94.122 1276 72 3 1 1273 551784712 551785987 0 1938
8 TraesCS2D01G383000 chr4A 94.122 1276 69 5 1 1273 418072976 418071704 0 1936
9 TraesCS2D01G383000 chr4A 94.104 1272 69 6 7 1273 588660107 588658837 0 1929
10 TraesCS2D01G383000 chr7A 94.182 1272 68 6 7 1273 141058407 141057137 0 1934
11 TraesCS2D01G383000 chr7A 94.182 1272 68 6 7 1273 141312578 141311308 0 1934
12 TraesCS2D01G383000 chr7A 94.104 1272 69 5 7 1273 141903680 141902410 0 1929
13 TraesCS2D01G383000 chr5D 99.002 1002 9 1 1276 2276 212031773 212030772 0 1794
14 TraesCS2D01G383000 chr5D 98.802 1002 11 1 1276 2276 289696756 289695755 0 1783
15 TraesCS2D01G383000 chr4D 98.902 1002 10 1 1276 2276 49933706 49932705 0 1788
16 TraesCS2D01G383000 chr4D 98.902 1002 10 1 1276 2276 365944535 365945536 0 1788
17 TraesCS2D01G383000 chr7D 98.804 1003 10 2 1276 2276 124061721 124060719 0 1784
18 TraesCS2D01G383000 chr1D 98.802 1002 11 1 1276 2276 27227040 27226039 0 1783


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G383000 chr2D 487334889 487337164 2275 True 4204 4204 100.000 1 2276 1 chr2D.!!$R3 2275
1 TraesCS2D01G383000 chr2D 487326526 487327527 1001 True 1783 1783 98.802 1276 2276 1 chr2D.!!$R2 1000
2 TraesCS2D01G383000 chr2D 379655970 379656971 1001 True 1777 1777 98.703 1276 2276 1 chr2D.!!$R1 1000
3 TraesCS2D01G383000 chr6D 450905959 450907229 1270 False 1978 1978 94.737 1 1273 1 chr6D.!!$F2 1272
4 TraesCS2D01G383000 chr6D 53163860 53164861 1001 False 1788 1788 98.902 1276 2276 1 chr6D.!!$F1 1000
5 TraesCS2D01G383000 chr3D 449746631 449747910 1279 False 1975 1975 94.614 1 1273 1 chr3D.!!$F1 1272
6 TraesCS2D01G383000 chr3D 593765075 593766351 1276 True 1956 1956 94.366 1 1273 1 chr3D.!!$R1 1272
7 TraesCS2D01G383000 chr4B 551784712 551785987 1275 False 1938 1938 94.122 1 1273 1 chr4B.!!$F1 1272
8 TraesCS2D01G383000 chr4A 418071704 418072976 1272 True 1936 1936 94.122 1 1273 1 chr4A.!!$R1 1272
9 TraesCS2D01G383000 chr4A 588658837 588660107 1270 True 1929 1929 94.104 7 1273 1 chr4A.!!$R2 1266
10 TraesCS2D01G383000 chr7A 141057137 141058407 1270 True 1934 1934 94.182 7 1273 1 chr7A.!!$R1 1266
11 TraesCS2D01G383000 chr7A 141311308 141312578 1270 True 1934 1934 94.182 7 1273 1 chr7A.!!$R2 1266
12 TraesCS2D01G383000 chr7A 141902410 141903680 1270 True 1929 1929 94.104 7 1273 1 chr7A.!!$R3 1266
13 TraesCS2D01G383000 chr5D 212030772 212031773 1001 True 1794 1794 99.002 1276 2276 1 chr5D.!!$R1 1000
14 TraesCS2D01G383000 chr5D 289695755 289696756 1001 True 1783 1783 98.802 1276 2276 1 chr5D.!!$R2 1000
15 TraesCS2D01G383000 chr4D 49932705 49933706 1001 True 1788 1788 98.902 1276 2276 1 chr4D.!!$R1 1000
16 TraesCS2D01G383000 chr4D 365944535 365945536 1001 False 1788 1788 98.902 1276 2276 1 chr4D.!!$F1 1000
17 TraesCS2D01G383000 chr7D 124060719 124061721 1002 True 1784 1784 98.804 1276 2276 1 chr7D.!!$R1 1000
18 TraesCS2D01G383000 chr1D 27226039 27227040 1001 True 1783 1783 98.802 1276 2276 1 chr1D.!!$R1 1000

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
155 162 0.466124 CACCGATTCTTCCTCCTCCC 59.534 60.000 0.00 0.0 0.00 4.30 F
464 473 1.208535 TGGTGTTCTCGAACTTGGTGT 59.791 47.619 10.75 0.0 41.67 4.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1152 1167 3.134623 TCACCATGTAGCCGATCTTGATT 59.865 43.478 0.00 0.00 0.0 2.57 R
1749 1765 3.711704 TGGGTTGAGTGATATCTTCCTCC 59.288 47.826 3.98 6.94 0.0 4.30 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 41 2.686915 GGCCTTCATCTTCTTGTCCATG 59.313 50.000 0.00 0.00 0.00 3.66
77 81 2.951745 CGTCATCGCTGTCGGAGC 60.952 66.667 0.00 0.00 45.20 4.70
85 89 3.579685 CTGTCGGAGCAGTCGAGA 58.420 61.111 0.00 0.00 37.31 4.04
105 109 1.135939 CGATCTGCCACGTACGACA 59.864 57.895 24.41 15.36 0.00 4.35
141 145 2.046988 CACTGGCATCTGCACCGA 60.047 61.111 4.33 0.00 44.36 4.69
155 162 0.466124 CACCGATTCTTCCTCCTCCC 59.534 60.000 0.00 0.00 0.00 4.30
376 383 1.600076 CAGCTCTTGTGCAGTGGCT 60.600 57.895 0.00 0.00 41.91 4.75
464 473 1.208535 TGGTGTTCTCGAACTTGGTGT 59.791 47.619 10.75 0.00 41.67 4.16
528 537 2.478803 CCCAAGGGAAGGGGTTGGT 61.479 63.158 0.00 0.00 42.90 3.67
736 745 3.415212 CCTGACTCCATGAATTGTGTGT 58.585 45.455 0.00 0.00 0.00 3.72
1101 1116 1.728971 GTGACGGTGAAGCTGATGAAG 59.271 52.381 0.00 0.00 0.00 3.02
1273 1288 0.667792 GAAGCACGACGAAGCCTTCT 60.668 55.000 0.00 0.00 0.00 2.85
1274 1289 0.601558 AAGCACGACGAAGCCTTCTA 59.398 50.000 0.00 0.00 0.00 2.10
1399 1415 2.778299 TCTTGGAGTACATGTGTTGGC 58.222 47.619 9.11 0.00 0.00 4.52
1417 1433 2.172505 TGGCTTCAAGGAGAGTTTGTGA 59.827 45.455 0.00 0.00 0.00 3.58
1749 1765 1.236616 TGTTCATGGGCTTGCGTCAG 61.237 55.000 0.00 0.00 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
85 89 0.029035 GTCGTACGTGGCAGATCGAT 59.971 55.000 16.05 0.00 0.00 3.59
155 162 1.457643 TCATCGGTGGGGAGCCTAG 60.458 63.158 0.00 0.00 0.00 3.02
376 383 0.179092 CTGATGCCGTGCTCATGAGA 60.179 55.000 27.04 8.75 28.50 3.27
475 484 1.192146 CCTTCTTCCTCGGGTGGTCA 61.192 60.000 0.00 0.00 0.00 4.02
736 745 4.092116 TCTCATTGCTCTCCTCGATCTA 57.908 45.455 0.00 0.00 0.00 1.98
873 882 4.175489 ATGCCCTCGTCGTCGTCG 62.175 66.667 5.50 5.50 38.33 5.12
875 884 4.129737 CCATGCCCTCGTCGTCGT 62.130 66.667 1.33 0.00 38.33 4.34
947 962 1.477558 CCTTGCAGAAGTGAGTTGGGT 60.478 52.381 0.00 0.00 0.00 4.51
1152 1167 3.134623 TCACCATGTAGCCGATCTTGATT 59.865 43.478 0.00 0.00 0.00 2.57
1399 1415 4.453819 GGTCATCACAAACTCTCCTTGAAG 59.546 45.833 0.00 0.00 0.00 3.02
1417 1433 5.450818 TTCCTTAATAGCACCTTGGTCAT 57.549 39.130 0.00 0.00 0.00 3.06
1749 1765 3.711704 TGGGTTGAGTGATATCTTCCTCC 59.288 47.826 3.98 6.94 0.00 4.30


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.