Multiple sequence alignment - TraesCS2D01G372900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G372900 chr2D 100.000 2268 0 0 1 2268 476789247 476791514 0.000000e+00 4189
1 TraesCS2D01G372900 chr2D 95.543 1548 63 4 1 1547 632766136 632767678 0.000000e+00 2471
2 TraesCS2D01G372900 chr2D 96.671 721 24 0 1548 2268 48362083 48362803 0.000000e+00 1199
3 TraesCS2D01G372900 chr2D 96.409 724 25 1 1546 2268 114569076 114569799 0.000000e+00 1192
4 TraesCS2D01G372900 chr2D 96.528 720 25 0 1549 2268 114585442 114584723 0.000000e+00 1192
5 TraesCS2D01G372900 chr2D 96.389 720 26 0 1549 2268 160355533 160354814 0.000000e+00 1186
6 TraesCS2D01G372900 chr1D 95.669 1547 60 2 1 1547 14674870 14673331 0.000000e+00 2479
7 TraesCS2D01G372900 chr1D 96.528 720 25 0 1549 2268 181789109 181788390 0.000000e+00 1192
8 TraesCS2D01G372900 chr6B 95.155 1548 70 3 1 1547 281223416 281221873 0.000000e+00 2438
9 TraesCS2D01G372900 chr4A 95.299 1489 66 1 59 1547 564697244 564698728 0.000000e+00 2359
10 TraesCS2D01G372900 chr5B 93.299 1552 94 4 1 1547 64293427 64294973 0.000000e+00 2281
11 TraesCS2D01G372900 chr5B 93.230 1551 97 3 1 1547 89726814 89728360 0.000000e+00 2276
12 TraesCS2D01G372900 chr5B 93.170 1552 96 5 1 1547 584816933 584815387 0.000000e+00 2270
13 TraesCS2D01G372900 chr2A 93.235 1552 89 8 1 1547 48624240 48622700 0.000000e+00 2270
14 TraesCS2D01G372900 chr2A 94.776 134 7 0 1414 1547 770003764 770003631 2.280000e-50 209
15 TraesCS2D01G372900 chr2B 93.843 1478 79 3 1 1471 546619162 546620634 0.000000e+00 2215
16 TraesCS2D01G372900 chr5D 96.810 721 20 3 1549 2268 375100639 375099921 0.000000e+00 1201
17 TraesCS2D01G372900 chr3D 96.667 720 24 0 1549 2268 440931481 440932200 0.000000e+00 1197
18 TraesCS2D01G372900 chr4D 96.533 721 25 0 1548 2268 352981017 352980297 0.000000e+00 1194
19 TraesCS2D01G372900 chr7D 96.528 720 25 0 1549 2268 308633462 308632743 0.000000e+00 1192


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G372900 chr2D 476789247 476791514 2267 False 4189 4189 100.000 1 2268 1 chr2D.!!$F3 2267
1 TraesCS2D01G372900 chr2D 632766136 632767678 1542 False 2471 2471 95.543 1 1547 1 chr2D.!!$F4 1546
2 TraesCS2D01G372900 chr2D 48362083 48362803 720 False 1199 1199 96.671 1548 2268 1 chr2D.!!$F1 720
3 TraesCS2D01G372900 chr2D 114569076 114569799 723 False 1192 1192 96.409 1546 2268 1 chr2D.!!$F2 722
4 TraesCS2D01G372900 chr2D 114584723 114585442 719 True 1192 1192 96.528 1549 2268 1 chr2D.!!$R1 719
5 TraesCS2D01G372900 chr2D 160354814 160355533 719 True 1186 1186 96.389 1549 2268 1 chr2D.!!$R2 719
6 TraesCS2D01G372900 chr1D 14673331 14674870 1539 True 2479 2479 95.669 1 1547 1 chr1D.!!$R1 1546
7 TraesCS2D01G372900 chr1D 181788390 181789109 719 True 1192 1192 96.528 1549 2268 1 chr1D.!!$R2 719
8 TraesCS2D01G372900 chr6B 281221873 281223416 1543 True 2438 2438 95.155 1 1547 1 chr6B.!!$R1 1546
9 TraesCS2D01G372900 chr4A 564697244 564698728 1484 False 2359 2359 95.299 59 1547 1 chr4A.!!$F1 1488
10 TraesCS2D01G372900 chr5B 64293427 64294973 1546 False 2281 2281 93.299 1 1547 1 chr5B.!!$F1 1546
11 TraesCS2D01G372900 chr5B 89726814 89728360 1546 False 2276 2276 93.230 1 1547 1 chr5B.!!$F2 1546
12 TraesCS2D01G372900 chr5B 584815387 584816933 1546 True 2270 2270 93.170 1 1547 1 chr5B.!!$R1 1546
13 TraesCS2D01G372900 chr2A 48622700 48624240 1540 True 2270 2270 93.235 1 1547 1 chr2A.!!$R1 1546
14 TraesCS2D01G372900 chr2B 546619162 546620634 1472 False 2215 2215 93.843 1 1471 1 chr2B.!!$F1 1470
15 TraesCS2D01G372900 chr5D 375099921 375100639 718 True 1201 1201 96.810 1549 2268 1 chr5D.!!$R1 719
16 TraesCS2D01G372900 chr3D 440931481 440932200 719 False 1197 1197 96.667 1549 2268 1 chr3D.!!$F1 719
17 TraesCS2D01G372900 chr4D 352980297 352981017 720 True 1194 1194 96.533 1548 2268 1 chr4D.!!$R1 720
18 TraesCS2D01G372900 chr7D 308632743 308633462 719 True 1192 1192 96.528 1549 2268 1 chr7D.!!$R1 719

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
287 289 0.529555 CAAAAACCGTTGGTGCCAGG 60.53 55.0 0.0 0.0 35.34 4.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1994 2013 1.132168 AGGGGAGGGTAGGACAAAAGT 60.132 52.381 0.0 0.0 0.0 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 9.208022 CAATACTCAAGTACACTTTCATCAAGA 57.792 33.333 0.00 0.0 33.20 3.02
211 213 4.825422 TGATCTATCAAATCGATGAGCCC 58.175 43.478 0.00 0.0 35.39 5.19
287 289 0.529555 CAAAAACCGTTGGTGCCAGG 60.530 55.000 0.00 0.0 35.34 4.45
479 481 1.144057 CCTGAGTATGACGGGCCAC 59.856 63.158 4.39 0.0 0.00 5.01
564 566 4.588106 CAGGAGTGACATGGATGATCTAGT 59.412 45.833 0.00 0.0 0.00 2.57
644 646 4.141981 ACAACAATTGTGGAGAATGCAACA 60.142 37.500 20.05 0.0 39.09 3.33
690 695 4.469657 TGCAAGAAACCTAGAACCAACAT 58.530 39.130 0.00 0.0 0.00 2.71
884 890 1.067213 TCGATGTGTTGCTCAATCCGA 60.067 47.619 0.00 0.0 0.00 4.55
946 963 7.468441 TGTTAACGTGTTGATATATTTGCCTG 58.532 34.615 0.26 0.0 0.00 4.85
1180 1198 2.668457 CGAAAGAAGTCATGGACGGAAG 59.332 50.000 0.00 0.0 37.67 3.46
1181 1199 2.770164 AAGAAGTCATGGACGGAAGG 57.230 50.000 0.00 0.0 37.67 3.46
1182 1200 1.938585 AGAAGTCATGGACGGAAGGA 58.061 50.000 0.00 0.0 37.67 3.36
1183 1201 2.257207 AGAAGTCATGGACGGAAGGAA 58.743 47.619 0.00 0.0 37.67 3.36
1463 1482 2.037385 AAGAGGCTTGGAGGAAGAGT 57.963 50.000 0.00 0.0 32.82 3.24
1486 1505 3.193691 GTCGTCAGAAAGAGAGGATGGAA 59.806 47.826 0.00 0.0 33.17 3.53
1812 1831 5.008613 TGGCAACAGAAAAGTAACTAAGCAG 59.991 40.000 0.00 0.0 46.17 4.24
1994 2013 4.998671 TGGAAAAGAACTTGCATGACAA 57.001 36.364 6.60 0.0 36.62 3.18
2013 2032 1.369403 ACTTTTGTCCTACCCTCCCC 58.631 55.000 0.00 0.0 0.00 4.81
2061 2080 7.086920 ACTAAGGGATATTAAGGCCTCCTTTA 58.913 38.462 21.13 15.2 41.69 1.85
2129 2148 4.532126 ACTCCTCAAACTATGGTCATCACA 59.468 41.667 0.00 0.0 0.00 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 5.401531 TGCTTTAGGAAGTACTCGTTGAT 57.598 39.130 0.00 0.00 35.25 2.57
144 146 4.764823 TCACTTGTTGTTTGGAAGACTTGT 59.235 37.500 0.00 0.00 0.00 3.16
211 213 1.599797 GTCCCTTGTTGTCCCACCG 60.600 63.158 0.00 0.00 0.00 4.94
287 289 0.685097 TACTTGTGTGGCCTCTCACC 59.315 55.000 18.29 6.41 36.78 4.02
479 481 1.996786 GCGGGATCTGGCACAATGTG 61.997 60.000 9.36 9.36 38.70 3.21
564 566 2.026729 TGCTTCATTCCGGTGTATCCAA 60.027 45.455 0.00 0.00 35.57 3.53
644 646 5.129634 TGTCCTAATGTTGTGTCATGTGTT 58.870 37.500 0.00 0.00 0.00 3.32
690 695 0.466543 ACGTGTTTGACTAGTGCCCA 59.533 50.000 0.00 0.00 0.00 5.36
738 743 1.225704 GTCCTTCCTCCATGGCCAG 59.774 63.158 13.05 3.10 35.26 4.85
884 890 9.034800 AGTACCATTCACATTATTTCAACCATT 57.965 29.630 0.00 0.00 0.00 3.16
925 931 6.509418 AACAGGCAAATATATCAACACGTT 57.491 33.333 0.00 0.00 0.00 3.99
927 933 7.468441 TGTAAACAGGCAAATATATCAACACG 58.532 34.615 0.00 0.00 0.00 4.49
1180 1198 6.333416 GCAAACAAAATATCTCCTTCCTTCC 58.667 40.000 0.00 0.00 0.00 3.46
1181 1199 6.333416 GGCAAACAAAATATCTCCTTCCTTC 58.667 40.000 0.00 0.00 0.00 3.46
1182 1200 5.187772 GGGCAAACAAAATATCTCCTTCCTT 59.812 40.000 0.00 0.00 0.00 3.36
1183 1201 4.711846 GGGCAAACAAAATATCTCCTTCCT 59.288 41.667 0.00 0.00 0.00 3.36
1463 1482 2.493675 CCATCCTCTCTTTCTGACGACA 59.506 50.000 0.00 0.00 0.00 4.35
1486 1505 3.916392 CTCCTCGCGTTGCTTCCGT 62.916 63.158 5.77 0.00 0.00 4.69
1673 1692 9.668497 AGATATTAAGTTTTCTAGGTGTGGTTC 57.332 33.333 0.00 0.00 0.00 3.62
1812 1831 6.595772 ACGAGCTTTTCACATATTGATCTC 57.404 37.500 0.00 0.00 32.84 2.75
1994 2013 1.132168 AGGGGAGGGTAGGACAAAAGT 60.132 52.381 0.00 0.00 0.00 2.66
2013 2032 1.544982 CCAATAGGATCCTGCTGCCAG 60.545 57.143 25.28 6.83 36.48 4.85
2061 2080 5.499004 TGCTTTGGTCTGGTACTCTATTT 57.501 39.130 0.00 0.00 0.00 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.