Multiple sequence alignment - TraesCS2D01G367300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G367300 chr2D 100.000 2495 0 0 1 2495 472113057 472110563 0 4608
1 TraesCS2D01G367300 chr2D 95.610 1549 44 20 968 2495 43303554 43305099 0 2462
2 TraesCS2D01G367300 chr2D 95.505 1535 59 8 968 2495 71662644 71661113 0 2444
3 TraesCS2D01G367300 chr2D 95.306 1534 57 12 968 2495 554523150 554524674 0 2420
4 TraesCS2D01G367300 chr2D 96.730 948 31 0 1 948 71663720 71662773 0 1580
5 TraesCS2D01G367300 chr2D 95.912 954 27 11 1 948 72477448 72476501 0 1535
6 TraesCS2D01G367300 chr5D 96.289 1536 48 7 968 2495 502716469 502718003 0 2512
7 TraesCS2D01G367300 chr5D 96.537 953 28 5 1 948 421305391 421304439 0 1572
8 TraesCS2D01G367300 chr5D 95.908 953 31 8 1 948 473023301 473024250 0 1537
9 TraesCS2D01G367300 chr4D 96.164 1538 46 10 968 2495 32703550 32705084 0 2501
10 TraesCS2D01G367300 chr4D 97.266 951 20 6 1 948 32702473 32703420 0 1607
11 TraesCS2D01G367300 chr7D 95.269 1543 53 18 968 2493 440173641 440172102 0 2427
12 TraesCS2D01G367300 chr7D 95.272 1544 46 20 968 2495 403434967 403433435 0 2422
13 TraesCS2D01G367300 chr7D 96.234 956 26 10 1 948 403436052 403435099 0 1557
14 TraesCS2D01G367300 chr6A 95.192 1539 58 12 968 2495 170528830 170530363 0 2418
15 TraesCS2D01G367300 chr6A 96.530 951 29 4 1 948 170527752 170528701 0 1570
16 TraesCS2D01G367300 chr1D 95.094 1549 52 19 968 2495 155913182 155914727 0 2418
17 TraesCS2D01G367300 chr1B 97.155 949 24 3 1 948 655071217 655072163 0 1600
18 TraesCS2D01G367300 chr5A 96.530 951 28 5 1 948 299116531 299115583 0 1568


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G367300 chr2D 472110563 472113057 2494 True 4608.0 4608 100.0000 1 2495 1 chr2D.!!$R2 2494
1 TraesCS2D01G367300 chr2D 43303554 43305099 1545 False 2462.0 2462 95.6100 968 2495 1 chr2D.!!$F1 1527
2 TraesCS2D01G367300 chr2D 554523150 554524674 1524 False 2420.0 2420 95.3060 968 2495 1 chr2D.!!$F2 1527
3 TraesCS2D01G367300 chr2D 71661113 71663720 2607 True 2012.0 2444 96.1175 1 2495 2 chr2D.!!$R3 2494
4 TraesCS2D01G367300 chr2D 72476501 72477448 947 True 1535.0 1535 95.9120 1 948 1 chr2D.!!$R1 947
5 TraesCS2D01G367300 chr5D 502716469 502718003 1534 False 2512.0 2512 96.2890 968 2495 1 chr5D.!!$F2 1527
6 TraesCS2D01G367300 chr5D 421304439 421305391 952 True 1572.0 1572 96.5370 1 948 1 chr5D.!!$R1 947
7 TraesCS2D01G367300 chr5D 473023301 473024250 949 False 1537.0 1537 95.9080 1 948 1 chr5D.!!$F1 947
8 TraesCS2D01G367300 chr4D 32702473 32705084 2611 False 2054.0 2501 96.7150 1 2495 2 chr4D.!!$F1 2494
9 TraesCS2D01G367300 chr7D 440172102 440173641 1539 True 2427.0 2427 95.2690 968 2493 1 chr7D.!!$R1 1525
10 TraesCS2D01G367300 chr7D 403433435 403436052 2617 True 1989.5 2422 95.7530 1 2495 2 chr7D.!!$R2 2494
11 TraesCS2D01G367300 chr6A 170527752 170530363 2611 False 1994.0 2418 95.8610 1 2495 2 chr6A.!!$F1 2494
12 TraesCS2D01G367300 chr1D 155913182 155914727 1545 False 2418.0 2418 95.0940 968 2495 1 chr1D.!!$F1 1527
13 TraesCS2D01G367300 chr1B 655071217 655072163 946 False 1600.0 1600 97.1550 1 948 1 chr1B.!!$F1 947
14 TraesCS2D01G367300 chr5A 299115583 299116531 948 True 1568.0 1568 96.5300 1 948 1 chr5A.!!$R1 947

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
763 775 3.602205 AAACTTGAAAGAAGGGAGGCT 57.398 42.857 0.0 0.0 0.0 4.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2287 2442 1.672356 GAGGAAGCCTCGCAGCAAA 60.672 57.895 0.0 0.0 41.08 3.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 7.485418 TTTACTGTATGAAACATGACGTTGT 57.515 32.000 0.00 0.00 38.07 3.32
76 77 6.220930 GTTGTTTATATCCACCATCGAGCTA 58.779 40.000 0.00 0.00 0.00 3.32
353 360 6.521151 GGAGTTTGTTCATCTCCAAATGAT 57.479 37.500 14.61 0.00 44.85 2.45
407 415 5.425217 TCATTGAGCAGTTGAGTTATAGGGA 59.575 40.000 0.00 0.00 0.00 4.20
436 444 7.450074 TGTATCTGGTTGTATCTGTTTTCAGT 58.550 34.615 0.00 0.00 46.98 3.41
476 486 5.239525 GTGTTTTCTTGTACAGAATGGCTCT 59.760 40.000 0.00 0.00 41.42 4.09
763 775 3.602205 AAACTTGAAAGAAGGGAGGCT 57.398 42.857 0.00 0.00 0.00 4.58
948 963 7.361457 TGCTCAGCTTAATATAGTAGGTTGT 57.639 36.000 0.00 0.00 0.00 3.32
950 965 8.265055 TGCTCAGCTTAATATAGTAGGTTGTTT 58.735 33.333 0.00 0.00 0.00 2.83
951 966 8.552034 GCTCAGCTTAATATAGTAGGTTGTTTG 58.448 37.037 6.17 1.39 0.00 2.93
952 967 9.817809 CTCAGCTTAATATAGTAGGTTGTTTGA 57.182 33.333 6.17 0.00 0.00 2.69
1161 1292 1.331756 GTTGCATATGAAGTGGAGCCG 59.668 52.381 6.97 0.00 0.00 5.52
1251 1382 9.403110 GAGTGGTGCAAAATGATAAATGATATC 57.597 33.333 0.00 0.00 0.00 1.63
1306 1437 3.503827 GGCTGGTTGTTGTTTATAGCC 57.496 47.619 0.00 0.00 41.92 3.93
1357 1488 2.961721 CACCGCGCGCATACTCAT 60.962 61.111 32.61 4.28 0.00 2.90
1360 1491 1.081442 CCGCGCGCATACTCATCTA 60.081 57.895 32.61 0.00 0.00 1.98
1372 1503 5.718146 CATACTCATCTACGCTGAATCCAT 58.282 41.667 0.00 0.00 0.00 3.41
1504 1636 7.624077 ACCTAGTGGTAAAATGATCTAGACCTT 59.376 37.037 0.00 0.00 46.43 3.50
1508 1640 5.163343 TGGTAAAATGATCTAGACCTTCCCG 60.163 44.000 0.00 0.00 0.00 5.14
1544 1679 8.793472 TCATTTTCATTTCGCGTTATATGTTTG 58.207 29.630 5.77 0.00 0.00 2.93
1768 1907 4.263331 GGAAGGGTGTCTATGGAAAGTTGA 60.263 45.833 0.00 0.00 0.00 3.18
1769 1908 5.501156 GAAGGGTGTCTATGGAAAGTTGAT 58.499 41.667 0.00 0.00 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 4.082408 CCGTAGCTCGATGGTGGATATAAA 60.082 45.833 7.07 0.00 42.86 1.40
76 77 4.839121 TCATAGTTGCAATAAAGGACCGT 58.161 39.130 0.59 0.00 0.00 4.83
353 360 4.842574 TGCATTTGGAGCTAACATCACTA 58.157 39.130 0.00 0.00 0.00 2.74
476 486 1.500108 CGCATGCCTTTTGCTTTTCA 58.500 45.000 13.15 0.00 42.00 2.69
763 775 8.579850 ACTTGAGCATTACATATTTCAAGGAA 57.420 30.769 14.31 0.00 43.43 3.36
962 977 2.677875 CACCCCCAAAGCTCCAGC 60.678 66.667 0.00 0.00 42.49 4.85
963 978 1.604593 CACACCCCCAAAGCTCCAG 60.605 63.158 0.00 0.00 0.00 3.86
966 981 1.531602 AAGCACACCCCCAAAGCTC 60.532 57.895 0.00 0.00 33.83 4.09
1102 1232 4.264352 TGGCAAACCCCAGATTCTTTCTAT 60.264 41.667 0.00 0.00 30.68 1.98
1161 1292 5.232463 TCATTGAACAACCTAACTACGTCC 58.768 41.667 0.00 0.00 0.00 4.79
1251 1382 2.049156 TCGTCAGCAACAGCTCCG 60.049 61.111 0.00 0.00 36.19 4.63
1263 1394 4.054780 AGCACTTAAGAACTTGTCGTCA 57.945 40.909 10.09 0.00 0.00 4.35
1306 1437 0.382636 GTCGTCGGTGCAAGAAAACG 60.383 55.000 0.00 0.00 0.00 3.60
1357 1488 2.101415 CCTCACATGGATTCAGCGTAGA 59.899 50.000 0.00 0.00 0.00 2.59
1360 1491 0.615331 ACCTCACATGGATTCAGCGT 59.385 50.000 0.00 0.00 0.00 5.07
1372 1503 6.713762 AACATTTGAATTCAGAACCTCACA 57.286 33.333 8.41 0.00 0.00 3.58
1520 1654 8.903570 TCAAACATATAACGCGAAATGAAAAT 57.096 26.923 15.93 0.00 0.00 1.82
1768 1907 8.405418 TCAGACAGTAAAGTGACACTTACTAT 57.595 34.615 20.85 13.19 37.47 2.12
1769 1908 7.812690 TCAGACAGTAAAGTGACACTTACTA 57.187 36.000 20.85 8.32 37.47 1.82
2287 2442 1.672356 GAGGAAGCCTCGCAGCAAA 60.672 57.895 0.00 0.00 41.08 3.68


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.