Multiple sequence alignment - TraesCS2D01G348900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G348900 chr2D 100.000 2893 0 0 1 2893 446698190 446695298 0.000000e+00 5343
1 TraesCS2D01G348900 chr2D 98.042 2911 38 9 1 2893 446728858 446725949 0.000000e+00 5042
2 TraesCS2D01G348900 chr2D 81.963 1131 142 27 816 1899 446653392 446652277 0.000000e+00 902
3 TraesCS2D01G348900 chr2D 83.036 1008 102 38 1195 2158 446932198 446933180 0.000000e+00 850
4 TraesCS2D01G348900 chr2D 84.471 747 105 4 3 739 70483023 70482278 0.000000e+00 726
5 TraesCS2D01G348900 chr2D 85.809 303 26 5 784 1070 446931895 446932196 3.620000e-79 305
6 TraesCS2D01G348900 chr2A 93.243 1983 76 21 788 2733 590966481 590964520 0.000000e+00 2867
7 TraesCS2D01G348900 chr2A 81.332 1141 144 32 816 1899 590817997 590816869 0.000000e+00 863
8 TraesCS2D01G348900 chr2A 82.394 1011 104 40 1197 2158 590974796 590973811 0.000000e+00 813
9 TraesCS2D01G348900 chr2A 87.829 304 20 4 784 1070 590975103 590974800 9.930000e-90 340
10 TraesCS2D01G348900 chr2B 91.691 1396 72 17 784 2138 526734616 526733224 0.000000e+00 1895
11 TraesCS2D01G348900 chr2B 81.449 1132 152 26 816 1899 526671141 526670020 0.000000e+00 874
12 TraesCS2D01G348900 chr4A 86.160 737 89 8 20 746 548303221 548302488 0.000000e+00 784
13 TraesCS2D01G348900 chr4A 82.075 742 117 13 6 743 24498829 24498100 1.140000e-173 619
14 TraesCS2D01G348900 chr3D 84.459 740 98 11 11 743 495217492 495218221 0.000000e+00 713
15 TraesCS2D01G348900 chr3D 84.660 691 91 7 6 693 155554615 155553937 0.000000e+00 675
16 TraesCS2D01G348900 chr6D 83.733 750 104 10 6 743 10714514 10715257 0.000000e+00 693
17 TraesCS2D01G348900 chr4D 83.580 743 109 7 6 739 350548766 350549504 0.000000e+00 684
18 TraesCS2D01G348900 chr4D 80.556 720 86 32 6 721 28472509 28473178 3.330000e-139 505
19 TraesCS2D01G348900 chr4D 76.796 362 62 13 2535 2885 381145655 381146005 1.770000e-42 183
20 TraesCS2D01G348900 chr7D 83.705 718 93 12 7 715 634886233 634886935 0.000000e+00 656
21 TraesCS2D01G348900 chr3B 82.591 741 113 8 6 743 675412785 675412058 8.740000e-180 640
22 TraesCS2D01G348900 chr5A 82.948 692 94 16 3 690 620478170 620477499 1.150000e-168 603
23 TraesCS2D01G348900 chr5B 81.766 691 102 15 56 744 119601349 119600681 9.060000e-155 556


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G348900 chr2D 446695298 446698190 2892 True 5343.0 5343 100.0000 1 2893 1 chr2D.!!$R3 2892
1 TraesCS2D01G348900 chr2D 446725949 446728858 2909 True 5042.0 5042 98.0420 1 2893 1 chr2D.!!$R4 2892
2 TraesCS2D01G348900 chr2D 446652277 446653392 1115 True 902.0 902 81.9630 816 1899 1 chr2D.!!$R2 1083
3 TraesCS2D01G348900 chr2D 70482278 70483023 745 True 726.0 726 84.4710 3 739 1 chr2D.!!$R1 736
4 TraesCS2D01G348900 chr2D 446931895 446933180 1285 False 577.5 850 84.4225 784 2158 2 chr2D.!!$F1 1374
5 TraesCS2D01G348900 chr2A 590964520 590966481 1961 True 2867.0 2867 93.2430 788 2733 1 chr2A.!!$R2 1945
6 TraesCS2D01G348900 chr2A 590816869 590817997 1128 True 863.0 863 81.3320 816 1899 1 chr2A.!!$R1 1083
7 TraesCS2D01G348900 chr2A 590973811 590975103 1292 True 576.5 813 85.1115 784 2158 2 chr2A.!!$R3 1374
8 TraesCS2D01G348900 chr2B 526733224 526734616 1392 True 1895.0 1895 91.6910 784 2138 1 chr2B.!!$R2 1354
9 TraesCS2D01G348900 chr2B 526670020 526671141 1121 True 874.0 874 81.4490 816 1899 1 chr2B.!!$R1 1083
10 TraesCS2D01G348900 chr4A 548302488 548303221 733 True 784.0 784 86.1600 20 746 1 chr4A.!!$R2 726
11 TraesCS2D01G348900 chr4A 24498100 24498829 729 True 619.0 619 82.0750 6 743 1 chr4A.!!$R1 737
12 TraesCS2D01G348900 chr3D 495217492 495218221 729 False 713.0 713 84.4590 11 743 1 chr3D.!!$F1 732
13 TraesCS2D01G348900 chr3D 155553937 155554615 678 True 675.0 675 84.6600 6 693 1 chr3D.!!$R1 687
14 TraesCS2D01G348900 chr6D 10714514 10715257 743 False 693.0 693 83.7330 6 743 1 chr6D.!!$F1 737
15 TraesCS2D01G348900 chr4D 350548766 350549504 738 False 684.0 684 83.5800 6 739 1 chr4D.!!$F2 733
16 TraesCS2D01G348900 chr4D 28472509 28473178 669 False 505.0 505 80.5560 6 721 1 chr4D.!!$F1 715
17 TraesCS2D01G348900 chr7D 634886233 634886935 702 False 656.0 656 83.7050 7 715 1 chr7D.!!$F1 708
18 TraesCS2D01G348900 chr3B 675412058 675412785 727 True 640.0 640 82.5910 6 743 1 chr3B.!!$R1 737
19 TraesCS2D01G348900 chr5A 620477499 620478170 671 True 603.0 603 82.9480 3 690 1 chr5A.!!$R1 687
20 TraesCS2D01G348900 chr5B 119600681 119601349 668 True 556.0 556 81.7660 56 744 1 chr5B.!!$R1 688

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
743 804 0.393808 TTATTTGAGGGGTGCTCGGC 60.394 55.0 0.0 0.0 0.0 5.54 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1901 2062 0.645355 GCGCGTCGATCAATTCAGAA 59.355 50.0 8.43 0.0 0.0 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
614 672 6.770303 TCAAATTTTGATAGTCCGATGGCATA 59.230 34.615 7.74 0.0 34.08 3.14
743 804 0.393808 TTATTTGAGGGGTGCTCGGC 60.394 55.000 0.00 0.0 0.00 5.54
781 842 0.512952 GTTTGCGCGGCTATAGATGG 59.487 55.000 8.83 0.0 0.00 3.51
1443 1599 4.753107 TCCAACTTAACACTGGACGAATTC 59.247 41.667 0.00 0.0 34.26 2.17
1901 2062 0.764890 TCACTTGCTAGGTGCTTGGT 59.235 50.000 0.00 0.0 43.37 3.67
2545 2732 4.631234 AGGTTGTGGATGAGGTTATCCTA 58.369 43.478 6.37 0.0 45.59 2.94
2615 2802 1.204704 CCAAGCTCACGTCCTGTATGA 59.795 52.381 0.00 0.0 0.00 2.15
2705 2892 2.561037 CGGTCCACAAAGCAACCCC 61.561 63.158 0.00 0.0 0.00 4.95
2860 3065 3.243501 GGGCAGGCATTATTACACACATG 60.244 47.826 0.00 0.0 0.00 3.21
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
17 18 2.456119 GCAGACCGTCATTGCCTCG 61.456 63.158 0.40 0.00 31.79 4.63
614 672 9.751542 CGATTACTCCATCACTTCTAACTAAAT 57.248 33.333 0.00 0.00 0.00 1.40
743 804 0.093026 CGTCCGCAAACGCTCTTTAG 59.907 55.000 0.00 0.00 38.22 1.85
781 842 4.082733 GGGGTCATGTTTCAAAGCTTAGAC 60.083 45.833 0.00 0.00 0.00 2.59
1443 1599 3.817647 GCCTGCTTAATTATGGAGAGGTG 59.182 47.826 17.94 5.76 0.00 4.00
1901 2062 0.645355 GCGCGTCGATCAATTCAGAA 59.355 50.000 8.43 0.00 0.00 3.02
2545 2732 3.319198 CGTGGGCCTACCTGGTGT 61.319 66.667 14.41 0.00 41.11 4.16
2615 2802 4.032960 TGTTGCTGACATTATCTTGGGT 57.967 40.909 0.00 0.00 32.00 4.51
2705 2892 4.559251 CCGAGTGAAGTTTATTCGAGTGAG 59.441 45.833 13.10 0.00 33.38 3.51
2860 3065 5.123344 CCTGGGTTGTTGTTAGCTACATTAC 59.877 44.000 0.00 0.00 36.44 1.89


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.