Multiple sequence alignment - TraesCS2D01G343500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G343500 chr2D 100.000 3071 0 0 1 3071 439936587 439933517 0.000000e+00 5672
1 TraesCS2D01G343500 chr2D 97.986 3078 40 4 1 3071 439680722 439683784 0.000000e+00 5321
2 TraesCS2D01G343500 chr2D 97.689 2207 26 3 872 3071 439693796 439695984 0.000000e+00 3770
3 TraesCS2D01G343500 chr2A 94.942 3005 90 10 84 3071 583266912 583263953 0.000000e+00 4650
4 TraesCS2D01G343500 chr2A 95.170 2940 91 16 161 3071 583098159 583095242 0.000000e+00 4595
5 TraesCS2D01G343500 chr2A 95.066 2939 96 14 161 3071 583105746 583102829 0.000000e+00 4578
6 TraesCS2D01G343500 chr2A 96.002 2326 74 9 269 2582 583254973 583252655 0.000000e+00 3762
7 TraesCS2D01G343500 chr2A 96.229 1803 58 5 1278 3071 583111360 583109559 0.000000e+00 2944
8 TraesCS2D01G343500 chr2A 95.321 1560 39 5 790 2333 582839797 582841338 0.000000e+00 2446
9 TraesCS2D01G343500 chr2A 95.251 737 33 2 2336 3071 582841383 582842118 0.000000e+00 1166
10 TraesCS2D01G343500 chr2A 100.000 85 0 0 1 85 583267120 583267036 1.140000e-34 158
11 TraesCS2D01G343500 chr2B 94.076 1536 64 4 269 1797 517750902 517752417 0.000000e+00 2307
12 TraesCS2D01G343500 chr2B 96.993 1297 31 3 1783 3071 517753893 517755189 0.000000e+00 2172
13 TraesCS2D01G343500 chr2B 95.930 1204 31 5 1871 3071 517746505 517747693 0.000000e+00 1936
14 TraesCS2D01G343500 chr2B 90.512 664 43 8 158 804 517758101 517758761 0.000000e+00 859
15 TraesCS2D01G343500 chr2B 97.783 451 9 1 346 796 517746064 517746513 0.000000e+00 776
16 TraesCS2D01G343500 chr2B 98.588 354 5 0 1 354 517739902 517740255 7.230000e-176 627
17 TraesCS2D01G343500 chr2B 91.667 108 7 1 158 265 517750566 517750671 6.860000e-32 148
18 TraesCS2D01G343500 chrUn 92.812 640 33 7 158 787 376841540 376842176 0.000000e+00 915
19 TraesCS2D01G343500 chrUn 95.661 507 20 2 2567 3071 315295688 315295182 0.000000e+00 813


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G343500 chr2D 439933517 439936587 3070 True 5672.000000 5672 100.0000 1 3071 1 chr2D.!!$R1 3070
1 TraesCS2D01G343500 chr2D 439680722 439683784 3062 False 5321.000000 5321 97.9860 1 3071 1 chr2D.!!$F1 3070
2 TraesCS2D01G343500 chr2D 439693796 439695984 2188 False 3770.000000 3770 97.6890 872 3071 1 chr2D.!!$F2 2199
3 TraesCS2D01G343500 chr2A 583095242 583098159 2917 True 4595.000000 4595 95.1700 161 3071 1 chr2A.!!$R1 2910
4 TraesCS2D01G343500 chr2A 583252655 583254973 2318 True 3762.000000 3762 96.0020 269 2582 1 chr2A.!!$R2 2313
5 TraesCS2D01G343500 chr2A 583102829 583111360 8531 True 3761.000000 4578 95.6475 161 3071 2 chr2A.!!$R3 2910
6 TraesCS2D01G343500 chr2A 583263953 583267120 3167 True 2404.000000 4650 97.4710 1 3071 2 chr2A.!!$R4 3070
7 TraesCS2D01G343500 chr2A 582839797 582842118 2321 False 1806.000000 2446 95.2860 790 3071 2 chr2A.!!$F1 2281
8 TraesCS2D01G343500 chr2B 517746064 517758761 12697 False 1366.333333 2307 94.4935 158 3071 6 chr2B.!!$F2 2913
9 TraesCS2D01G343500 chrUn 376841540 376842176 636 False 915.000000 915 92.8120 158 787 1 chrUn.!!$F1 629
10 TraesCS2D01G343500 chrUn 315295182 315295688 506 True 813.000000 813 95.6610 2567 3071 1 chrUn.!!$R1 504

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1137 6840 0.041238 TCCTCCACTTCTCCGATGGT 59.959 55.0 0.0 0.0 34.89 3.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2258 9463 1.067295 TGTCCCTCCATGTCTTGCTT 58.933 50.0 0.0 0.0 0.0 3.91 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1137 6840 0.041238 TCCTCCACTTCTCCGATGGT 59.959 55.000 0.00 0.0 34.89 3.55
2293 9498 6.214615 TGGAGGGACATTGAATACTTTGAGTA 59.785 38.462 0.00 0.0 34.82 2.59
2337 9584 9.224267 CCGAGCTAGTGGTTTAATACTAGTATA 57.776 37.037 15.74 0.0 45.12 1.47
2900 10151 1.675552 CTCTCTCTCCTCGAAGACCC 58.324 60.000 0.00 0.0 0.00 4.46
2901 10152 0.107606 TCTCTCTCCTCGAAGACCCG 60.108 60.000 0.00 0.0 0.00 5.28
3006 10257 4.377708 AGCACGCATCGCAGTCCA 62.378 61.111 0.00 0.0 0.00 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
246 5701 0.544357 ACCTAGGCACCACTGCTACA 60.544 55.000 9.3 0.0 43.66 2.74
487 6169 1.296392 CCGCCTCAGATGGTTGTCA 59.704 57.895 0.0 0.0 0.00 3.58
2258 9463 1.067295 TGTCCCTCCATGTCTTGCTT 58.933 50.000 0.0 0.0 0.00 3.91
2293 9498 2.571653 TCGGGAGAAAAGATCCACATGT 59.428 45.455 0.0 0.0 38.70 3.21
2570 9817 4.934001 GGTAGTCTAGGTTACAACTTTGCC 59.066 45.833 0.0 0.0 0.00 4.52
2880 10131 1.675552 GGTCTTCGAGGAGAGAGAGG 58.324 60.000 0.0 0.0 0.00 3.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.