Multiple sequence alignment - TraesCS2D01G334600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G334600 chr2D 100.000 2618 0 0 1 2618 427924601 427927218 0.000000e+00 4835
1 TraesCS2D01G334600 chr2D 95.258 1645 58 5 1 1639 427943829 427945459 0.000000e+00 2588
2 TraesCS2D01G334600 chr2D 93.212 1488 71 10 177 1638 427909006 427910489 0.000000e+00 2161
3 TraesCS2D01G334600 chr2D 87.924 1681 129 25 1 1639 427783704 427785352 0.000000e+00 1912
4 TraesCS2D01G334600 chr2D 98.165 981 15 1 1638 2618 631392400 631391423 0.000000e+00 1709
5 TraesCS2D01G334600 chr2D 90.343 1253 89 12 1 1222 427905269 427906520 0.000000e+00 1615
6 TraesCS2D01G334600 chr2D 85.017 881 85 28 715 1571 427897825 427898682 0.000000e+00 852
7 TraesCS2D01G334600 chr2D 82.743 875 94 26 716 1571 427753232 427754068 0.000000e+00 726
8 TraesCS2D01G334600 chr2B 88.941 1700 93 34 1 1638 512358801 512357135 0.000000e+00 2010
9 TraesCS2D01G334600 chr2B 92.537 1139 51 15 523 1638 504769773 504770900 0.000000e+00 1602
10 TraesCS2D01G334600 chr2B 85.948 918 87 18 6 894 512365150 512364246 0.000000e+00 942
11 TraesCS2D01G334600 chr2B 88.845 511 47 5 1 510 504769229 504769730 1.030000e-173 619
12 TraesCS2D01G334600 chr2A 87.327 1665 153 18 1 1638 559779369 559777736 0.000000e+00 1853
13 TraesCS2D01G334600 chr2A 91.010 1357 90 8 1 1332 559837592 559836243 0.000000e+00 1801
14 TraesCS2D01G334600 chr2A 93.243 666 45 0 716 1381 559741263 559740598 0.000000e+00 981
15 TraesCS2D01G334600 chr2A 89.391 509 51 2 1 508 559742841 559742335 2.840000e-179 638
16 TraesCS2D01G334600 chr2A 85.256 624 59 14 1 609 559741869 559741264 1.720000e-171 612
17 TraesCS2D01G334600 chr5D 98.267 981 14 1 1638 2618 142663910 142664887 0.000000e+00 1714
18 TraesCS2D01G334600 chr5D 98.165 981 14 2 1638 2618 428686519 428687495 0.000000e+00 1709
19 TraesCS2D01G334600 chr4D 98.167 982 14 2 1637 2618 308742989 308743966 0.000000e+00 1711
20 TraesCS2D01G334600 chr4D 98.065 982 15 2 1637 2618 391442115 391441138 0.000000e+00 1705
21 TraesCS2D01G334600 chr1D 98.167 982 14 2 1637 2618 153888296 153889273 0.000000e+00 1711
22 TraesCS2D01G334600 chr1D 97.586 994 19 3 1626 2618 286173252 286172263 0.000000e+00 1698
23 TraesCS2D01G334600 chrUn 98.065 982 15 2 1637 2618 389833521 389832544 0.000000e+00 1705
24 TraesCS2D01G334600 chr6D 98.065 982 15 2 1637 2618 354627412 354626435 0.000000e+00 1705


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G334600 chr2D 427924601 427927218 2617 False 4835.000000 4835 100.000000 1 2618 1 chr2D.!!$F4 2617
1 TraesCS2D01G334600 chr2D 427943829 427945459 1630 False 2588.000000 2588 95.258000 1 1639 1 chr2D.!!$F5 1638
2 TraesCS2D01G334600 chr2D 427783704 427785352 1648 False 1912.000000 1912 87.924000 1 1639 1 chr2D.!!$F2 1638
3 TraesCS2D01G334600 chr2D 427905269 427910489 5220 False 1888.000000 2161 91.777500 1 1638 2 chr2D.!!$F6 1637
4 TraesCS2D01G334600 chr2D 631391423 631392400 977 True 1709.000000 1709 98.165000 1638 2618 1 chr2D.!!$R1 980
5 TraesCS2D01G334600 chr2D 427897825 427898682 857 False 852.000000 852 85.017000 715 1571 1 chr2D.!!$F3 856
6 TraesCS2D01G334600 chr2D 427753232 427754068 836 False 726.000000 726 82.743000 716 1571 1 chr2D.!!$F1 855
7 TraesCS2D01G334600 chr2B 512357135 512358801 1666 True 2010.000000 2010 88.941000 1 1638 1 chr2B.!!$R1 1637
8 TraesCS2D01G334600 chr2B 504769229 504770900 1671 False 1110.500000 1602 90.691000 1 1638 2 chr2B.!!$F1 1637
9 TraesCS2D01G334600 chr2B 512364246 512365150 904 True 942.000000 942 85.948000 6 894 1 chr2B.!!$R2 888
10 TraesCS2D01G334600 chr2A 559777736 559779369 1633 True 1853.000000 1853 87.327000 1 1638 1 chr2A.!!$R1 1637
11 TraesCS2D01G334600 chr2A 559836243 559837592 1349 True 1801.000000 1801 91.010000 1 1332 1 chr2A.!!$R2 1331
12 TraesCS2D01G334600 chr2A 559740598 559742841 2243 True 743.666667 981 89.296667 1 1381 3 chr2A.!!$R3 1380
13 TraesCS2D01G334600 chr5D 142663910 142664887 977 False 1714.000000 1714 98.267000 1638 2618 1 chr5D.!!$F1 980
14 TraesCS2D01G334600 chr5D 428686519 428687495 976 False 1709.000000 1709 98.165000 1638 2618 1 chr5D.!!$F2 980
15 TraesCS2D01G334600 chr4D 308742989 308743966 977 False 1711.000000 1711 98.167000 1637 2618 1 chr4D.!!$F1 981
16 TraesCS2D01G334600 chr4D 391441138 391442115 977 True 1705.000000 1705 98.065000 1637 2618 1 chr4D.!!$R1 981
17 TraesCS2D01G334600 chr1D 153888296 153889273 977 False 1711.000000 1711 98.167000 1637 2618 1 chr1D.!!$F1 981
18 TraesCS2D01G334600 chr1D 286172263 286173252 989 True 1698.000000 1698 97.586000 1626 2618 1 chr1D.!!$R1 992
19 TraesCS2D01G334600 chrUn 389832544 389833521 977 True 1705.000000 1705 98.065000 1637 2618 1 chrUn.!!$R1 981
20 TraesCS2D01G334600 chr6D 354626435 354627412 977 True 1705.000000 1705 98.065000 1637 2618 1 chr6D.!!$R1 981

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
850 5416 1.30463 TGCCAACTGCCATGATGCT 60.305 52.632 0.0 0.0 40.16 3.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1911 6510 0.461548 ATCATCATCGTCACCACGCT 59.538 50.0 0.0 0.0 46.28 5.07 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
92 95 5.445964 TGAATTAAGGACTTAGGGAATGCC 58.554 41.667 0.00 0.0 0.00 4.40
100 103 1.615165 TTAGGGAATGCCGTGGCGTA 61.615 55.000 5.94 0.0 45.51 4.42
207 210 2.872557 TCGACGGCGAATCGTTCT 59.127 55.556 13.07 0.0 44.78 3.01
521 564 5.405935 ACTTGTTTCAGAAAAGCAACCTT 57.594 34.783 0.00 0.0 0.00 3.50
666 4285 3.365265 CTTGGGCCAAGCACGACC 61.365 66.667 31.72 0.0 34.63 4.79
850 5416 1.304630 TGCCAACTGCCATGATGCT 60.305 52.632 0.00 0.0 40.16 3.79
942 5522 3.330405 TCTCTGATCCACCCAACATTTCA 59.670 43.478 0.00 0.0 0.00 2.69
1819 6418 2.684881 ACCGATCAAGTACCGAACGTAT 59.315 45.455 10.35 0.0 0.00 3.06
2094 6694 1.002274 GAGCAAGGGAGGAGGAGGA 59.998 63.158 0.00 0.0 0.00 3.71
2095 6695 1.002792 AGCAAGGGAGGAGGAGGAG 59.997 63.158 0.00 0.0 0.00 3.69
2096 6696 2.069430 GCAAGGGAGGAGGAGGAGG 61.069 68.421 0.00 0.0 0.00 4.30
2552 7152 2.543238 CCTACGGGTTCGAGAACTATGC 60.543 54.545 14.62 0.0 40.94 3.14
2557 7157 2.186076 GGTTCGAGAACTATGCAGACG 58.814 52.381 14.62 0.0 40.94 4.18
2605 7205 0.250467 CAATAGCGGGACCTGGATGG 60.250 60.000 0.00 0.0 42.93 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
92 95 1.073177 CTAGGTTTTGGTACGCCACG 58.927 55.000 0.00 0.0 46.01 4.94
100 103 2.576648 GGAGGGTGATCTAGGTTTTGGT 59.423 50.000 0.00 0.0 0.00 3.67
666 4285 0.111266 CGTCTCGGCTTTGTTTCACG 60.111 55.000 0.00 0.0 0.00 4.35
942 5522 1.904865 TAGGTTCTGTGGGCGACGT 60.905 57.895 0.00 0.0 0.00 4.34
1386 5973 0.539986 GGTACTCCTTCATCCGCCAA 59.460 55.000 0.00 0.0 0.00 4.52
1464 6051 1.361271 GTGGACCACGAAGACGACA 59.639 57.895 9.33 0.0 42.66 4.35
1819 6418 0.541063 TGTAGAACTCGGAGGTGCCA 60.541 55.000 10.23 0.0 35.94 4.92
1911 6510 0.461548 ATCATCATCGTCACCACGCT 59.538 50.000 0.00 0.0 46.28 5.07
2249 6849 3.590574 GCACCCCTCCCCTTGGTT 61.591 66.667 0.00 0.0 0.00 3.67
2552 7152 4.535425 GTGTCTCGGTCACGTCTG 57.465 61.111 0.00 0.0 41.85 3.51
2557 7157 4.843101 GAGACGTGTCTCGGTCAC 57.157 61.111 13.75 0.0 45.49 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.