Multiple sequence alignment - TraesCS2D01G319000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G319000 chr2D 100.000 3293 0 0 1 3293 409435752 409439044 0.000000e+00 6082
1 TraesCS2D01G319000 chr2D 97.820 3303 57 7 1 3290 412563548 412560248 0.000000e+00 5686
2 TraesCS2D01G319000 chr2D 97.519 3305 66 5 1 3290 411882576 411885879 0.000000e+00 5635
3 TraesCS2D01G319000 chr1D 97.245 3303 74 7 1 3290 265083885 265087183 0.000000e+00 5579
4 TraesCS2D01G319000 chr1D 90.905 2430 196 14 1 2426 243667511 243669919 0.000000e+00 3240
5 TraesCS2D01G319000 chr1D 88.310 864 73 7 2428 3290 243670046 243670882 0.000000e+00 1011
6 TraesCS2D01G319000 chr5B 95.534 3314 118 9 1 3290 345943828 345940521 0.000000e+00 5273
7 TraesCS2D01G319000 chr5B 95.232 3314 128 9 1 3290 346300768 346297461 0.000000e+00 5217
8 TraesCS2D01G319000 chr6D 95.490 3304 118 13 1 3290 287205977 287202691 0.000000e+00 5247
9 TraesCS2D01G319000 chr1B 95.720 1799 50 7 1226 3000 212433212 212431417 0.000000e+00 2870
10 TraesCS2D01G319000 chr1B 94.295 298 14 1 2996 3290 212425911 212425614 1.390000e-123 453
11 TraesCS2D01G319000 chr7B 95.855 1761 63 7 1 1759 367728022 367729774 0.000000e+00 2839
12 TraesCS2D01G319000 chr7B 95.168 1490 58 4 1811 3288 367731214 367732701 0.000000e+00 2340
13 TraesCS2D01G319000 chr3D 90.725 1973 161 14 1 1970 243832823 243830870 0.000000e+00 2610
14 TraesCS2D01G319000 chr7D 80.793 656 114 7 1778 2426 305337043 305337693 1.360000e-138 503


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G319000 chr2D 409435752 409439044 3292 False 6082.0 6082 100.0000 1 3293 1 chr2D.!!$F1 3292
1 TraesCS2D01G319000 chr2D 412560248 412563548 3300 True 5686.0 5686 97.8200 1 3290 1 chr2D.!!$R1 3289
2 TraesCS2D01G319000 chr2D 411882576 411885879 3303 False 5635.0 5635 97.5190 1 3290 1 chr2D.!!$F2 3289
3 TraesCS2D01G319000 chr1D 265083885 265087183 3298 False 5579.0 5579 97.2450 1 3290 1 chr1D.!!$F1 3289
4 TraesCS2D01G319000 chr1D 243667511 243670882 3371 False 2125.5 3240 89.6075 1 3290 2 chr1D.!!$F2 3289
5 TraesCS2D01G319000 chr5B 345940521 345943828 3307 True 5273.0 5273 95.5340 1 3290 1 chr5B.!!$R1 3289
6 TraesCS2D01G319000 chr5B 346297461 346300768 3307 True 5217.0 5217 95.2320 1 3290 1 chr5B.!!$R2 3289
7 TraesCS2D01G319000 chr6D 287202691 287205977 3286 True 5247.0 5247 95.4900 1 3290 1 chr6D.!!$R1 3289
8 TraesCS2D01G319000 chr1B 212431417 212433212 1795 True 2870.0 2870 95.7200 1226 3000 1 chr1B.!!$R2 1774
9 TraesCS2D01G319000 chr7B 367728022 367732701 4679 False 2589.5 2839 95.5115 1 3288 2 chr7B.!!$F1 3287
10 TraesCS2D01G319000 chr3D 243830870 243832823 1953 True 2610.0 2610 90.7250 1 1970 1 chr3D.!!$R1 1969
11 TraesCS2D01G319000 chr7D 305337043 305337693 650 False 503.0 503 80.7930 1778 2426 1 chr7D.!!$F1 648

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
173 177 1.967319 TCCACAAGAGACAGCCAAAC 58.033 50.000 0.00 0.0 0.00 2.93 F
1065 1072 1.329906 TGCCGCAAATGCAACAAAAAG 59.670 42.857 6.18 0.0 42.21 2.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2164 3569 1.625818 CTCCTGAGTACCTGCCTGTTT 59.374 52.381 0.0 0.0 0.0 2.83 R
2562 4103 4.870123 TGTTTGGCTGTCATATGCTTTT 57.130 36.364 0.0 0.0 0.0 2.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
173 177 1.967319 TCCACAAGAGACAGCCAAAC 58.033 50.000 0.00 0.00 0.00 2.93
350 355 5.985530 TCGAGATATTGTGCTTCGAATTGAT 59.014 36.000 0.00 0.00 0.00 2.57
638 644 4.274705 CAGAGTACTCGCTGTCATCTACAT 59.725 45.833 17.07 0.00 36.87 2.29
646 652 2.879826 CTGTCATCTACATGTGCGACA 58.120 47.619 9.11 13.61 37.50 4.35
684 690 8.413229 CGATTTGGATATCCCTAAAACAAATGT 58.587 33.333 19.34 0.00 37.24 2.71
1065 1072 1.329906 TGCCGCAAATGCAACAAAAAG 59.670 42.857 6.18 0.00 42.21 2.27
1119 1126 5.358442 TCCGAAATGTCAAAAAGAACCTGAA 59.642 36.000 0.00 0.00 0.00 3.02
1674 1686 7.463618 AGATGGAGGATGATAAACCCATTCTAT 59.536 37.037 0.00 0.00 34.83 1.98
2010 3415 3.929610 GGAGAAGTAGCACAACTCATGTC 59.070 47.826 0.00 0.00 41.46 3.06
2164 3569 7.528996 AACAATCACCATGAAGAAGAATCAA 57.471 32.000 0.00 0.00 0.00 2.57
2435 3971 5.435686 AGTAAAGTCATTAGCACATGGGA 57.564 39.130 0.00 0.00 0.00 4.37
2479 4019 8.722342 AAAACATTGTCATTTATCGTACACAC 57.278 30.769 0.00 0.00 0.00 3.82
2562 4103 5.529581 TCACATGTTGAGACACTACAGAA 57.470 39.130 0.00 0.00 38.91 3.02
2590 4131 5.712004 CATATGACAGCCAAACAATCAACA 58.288 37.500 0.00 0.00 0.00 3.33
2830 4381 4.660105 GAGATAAGGAGTCGTGTGTGTAC 58.340 47.826 0.00 0.00 0.00 2.90
3004 4557 5.668558 AAAACGTACAGATGACAAACTCC 57.331 39.130 0.00 0.00 0.00 3.85
3140 4693 6.161855 ACATGCAATAATTAGTCCTCTCGA 57.838 37.500 0.00 0.00 0.00 4.04
3162 4715 1.239968 GCAACAAGGAGCAGACAGGG 61.240 60.000 0.00 0.00 0.00 4.45
3229 4782 8.839343 CACAAATAATACATGCATGTCTCCTTA 58.161 33.333 34.54 24.57 41.97 2.69
3290 4849 9.840427 ATTACACATGCTTTGTATTAACTTGAC 57.160 29.630 0.00 0.00 36.57 3.18
3291 4850 7.270757 ACACATGCTTTGTATTAACTTGACA 57.729 32.000 0.00 0.00 36.57 3.58
3292 4851 7.362662 ACACATGCTTTGTATTAACTTGACAG 58.637 34.615 0.00 0.00 36.57 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
596 602 7.578310 ACTCTGCATGCACTTTGATATATTT 57.422 32.000 18.46 0.00 0.00 1.40
638 644 4.989044 TCGATATAAACTCTTGTCGCACA 58.011 39.130 0.00 0.00 0.00 4.57
646 652 9.892130 GGGATATCCAAATCGATATAAACTCTT 57.108 33.333 23.27 0.00 35.92 2.85
674 680 4.566360 CCTCGTTTGAAGCACATTTGTTTT 59.434 37.500 0.00 0.00 0.00 2.43
684 690 2.354510 CTGTTTCACCTCGTTTGAAGCA 59.645 45.455 10.59 10.59 40.57 3.91
1065 1072 2.882761 GTGGTTCCCTTGTTTCTGTACC 59.117 50.000 0.00 0.00 0.00 3.34
1119 1126 8.599624 ATGAAATTCACCTTGGACATATCTTT 57.400 30.769 0.00 0.00 0.00 2.52
1494 1504 9.099071 AGTAGAAATAGATGATACCTGCTCAAT 57.901 33.333 0.00 0.00 0.00 2.57
1674 1686 6.208994 GTCCTCCTAGTCTTTTTAGTGTCTGA 59.791 42.308 0.00 0.00 0.00 3.27
1746 1758 7.772757 GGGTTCATCTTTCTCTTGACTATTCAT 59.227 37.037 0.00 0.00 0.00 2.57
1749 1761 7.020827 TGGGTTCATCTTTCTCTTGACTATT 57.979 36.000 0.00 0.00 0.00 1.73
1770 1782 9.347240 AGATTTCTTATCAACAACAGATATGGG 57.653 33.333 0.00 0.00 0.00 4.00
2010 3415 2.056577 GGTTCTTCGTCAAGGTGTACG 58.943 52.381 0.00 0.00 40.40 3.67
2070 3475 2.037687 TTGGGGCCTGCTTCCATG 59.962 61.111 0.84 0.00 0.00 3.66
2164 3569 1.625818 CTCCTGAGTACCTGCCTGTTT 59.374 52.381 0.00 0.00 0.00 2.83
2408 3819 7.283127 CCCATGTGCTAATGACTTTACTAACAT 59.717 37.037 0.00 0.00 0.00 2.71
2479 4019 6.415867 GGATGAACATGTGAAAATCGCTAATG 59.584 38.462 0.00 0.00 0.00 1.90
2562 4103 4.870123 TGTTTGGCTGTCATATGCTTTT 57.130 36.364 0.00 0.00 0.00 2.27
2590 4131 4.948004 AGAACAGATGATGATGTGCACATT 59.052 37.500 31.82 18.43 36.57 2.71
2830 4381 9.918630 ATTGTTTTTCTTCAGAGAATTGTATGG 57.081 29.630 0.00 0.00 41.35 2.74
3004 4557 6.465084 AGTTAAGGCTAGAGTTTGTAGGTTG 58.535 40.000 0.00 0.00 0.00 3.77
3140 4693 0.181114 TGTCTGCTCCTTGTTGCTGT 59.819 50.000 0.00 0.00 0.00 4.40
3162 4715 1.867233 CCTGCAAGTACTGTCACACAC 59.133 52.381 0.00 0.00 0.00 3.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.