Multiple sequence alignment - TraesCS2D01G317900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G317900 chr2D 100.000 2705 0 0 995 3699 407227417 407224713 0.000000e+00 4996.0
1 TraesCS2D01G317900 chr2D 80.824 704 121 11 1969 2663 43798685 43797987 1.170000e-149 540.0
2 TraesCS2D01G317900 chr2D 100.000 167 0 0 1 167 407228411 407228245 3.590000e-80 309.0
3 TraesCS2D01G317900 chr2D 73.383 541 120 20 2014 2540 413778647 413778117 2.940000e-41 180.0
4 TraesCS2D01G317900 chr4D 99.520 2710 7 3 995 3699 328997292 329000000 0.000000e+00 4927.0
5 TraesCS2D01G317900 chr4D 98.990 99 0 1 69 167 328996582 328996679 3.800000e-40 176.0
6 TraesCS2D01G317900 chr1B 97.968 2362 27 5 998 3339 135964415 135962055 0.000000e+00 4076.0
7 TraesCS2D01G317900 chr1B 97.838 370 7 1 3330 3699 135961376 135961008 4.030000e-179 638.0
8 TraesCS2D01G317900 chr4A 97.041 1994 40 6 998 2978 141131940 141129953 0.000000e+00 3338.0
9 TraesCS2D01G317900 chr4A 95.023 663 26 5 3041 3698 141125754 141125094 0.000000e+00 1035.0
10 TraesCS2D01G317900 chr4B 95.747 1975 58 14 995 2959 408949847 408951805 0.000000e+00 3158.0
11 TraesCS2D01G317900 chr4B 84.975 599 56 20 3120 3699 408952016 408952599 8.910000e-161 577.0
12 TraesCS2D01G317900 chr4B 94.595 37 1 1 2975 3011 408951956 408951991 5.160000e-04 56.5
13 TraesCS2D01G317900 chrUn 97.838 370 7 1 3330 3699 377051895 377051527 4.030000e-179 638.0
14 TraesCS2D01G317900 chrUn 98.182 165 2 1 3175 3339 377053124 377052961 1.680000e-73 287.0
15 TraesCS2D01G317900 chr2B 78.695 981 183 19 998 1969 68424478 68423515 6.740000e-177 630.0
16 TraesCS2D01G317900 chr2B 80.797 703 123 9 1969 2663 68423274 68422576 1.170000e-149 540.0
17 TraesCS2D01G317900 chr2B 92.638 163 12 0 3536 3698 695690214 695690052 6.180000e-58 235.0
18 TraesCS2D01G317900 chr2A 80.540 704 123 13 1969 2663 46114418 46113720 2.530000e-146 529.0
19 TraesCS2D01G317900 chr2A 73.383 541 120 20 2014 2540 580853419 580852889 2.940000e-41 180.0
20 TraesCS2D01G317900 chr7D 84.656 378 31 13 3323 3699 113715549 113715198 5.880000e-93 351.0
21 TraesCS2D01G317900 chr7B 82.609 414 42 14 3287 3698 73312213 73311828 4.580000e-89 339.0
22 TraesCS2D01G317900 chr7B 84.570 337 31 9 3363 3698 73331937 73331621 7.710000e-82 315.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G317900 chr2D 407224713 407228411 3698 True 2652.500000 4996 100.000000 1 3699 2 chr2D.!!$R3 3698
1 TraesCS2D01G317900 chr2D 43797987 43798685 698 True 540.000000 540 80.824000 1969 2663 1 chr2D.!!$R1 694
2 TraesCS2D01G317900 chr4D 328996582 329000000 3418 False 2551.500000 4927 99.255000 69 3699 2 chr4D.!!$F1 3630
3 TraesCS2D01G317900 chr1B 135961008 135964415 3407 True 2357.000000 4076 97.903000 998 3699 2 chr1B.!!$R1 2701
4 TraesCS2D01G317900 chr4A 141129953 141131940 1987 True 3338.000000 3338 97.041000 998 2978 1 chr4A.!!$R2 1980
5 TraesCS2D01G317900 chr4A 141125094 141125754 660 True 1035.000000 1035 95.023000 3041 3698 1 chr4A.!!$R1 657
6 TraesCS2D01G317900 chr4B 408949847 408952599 2752 False 1263.833333 3158 91.772333 995 3699 3 chr4B.!!$F1 2704
7 TraesCS2D01G317900 chrUn 377051527 377053124 1597 True 462.500000 638 98.010000 3175 3699 2 chrUn.!!$R1 524
8 TraesCS2D01G317900 chr2B 68422576 68424478 1902 True 585.000000 630 79.746000 998 2663 2 chr2B.!!$R2 1665
9 TraesCS2D01G317900 chr2A 46113720 46114418 698 True 529.000000 529 80.540000 1969 2663 1 chr2A.!!$R1 694

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
63 64 9.757227 TGTTCAAAGAAAGAGAAAGAAAACAAA 57.243 25.926 0.00 0.0 0.00 2.83 F
1765 1778 1.373748 GCGGCGACTACAAGACCAA 60.374 57.895 12.98 0.0 0.00 3.67 F
2586 2851 1.795768 CAGGCGCAAGAGAAGTACAA 58.204 50.000 10.83 0.0 43.02 2.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2189 2443 1.134098 CAGTTCTGGAACACCACCTGT 60.134 52.381 14.67 0.0 43.47 4.00 R
2586 2851 0.811915 CTGGATGAACCTCTCGACGT 59.188 55.000 0.00 0.0 39.86 4.34 R
3566 5096 2.601067 TACCTCGTCGCCAACCCA 60.601 61.111 0.00 0.0 0.00 4.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
61 62 9.927668 AATGTTCAAAGAAAGAGAAAGAAAACA 57.072 25.926 0.00 0.0 0.00 2.83
62 63 9.927668 ATGTTCAAAGAAAGAGAAAGAAAACAA 57.072 25.926 0.00 0.0 0.00 2.83
63 64 9.757227 TGTTCAAAGAAAGAGAAAGAAAACAAA 57.243 25.926 0.00 0.0 0.00 2.83
1765 1778 1.373748 GCGGCGACTACAAGACCAA 60.374 57.895 12.98 0.0 0.00 3.67
2586 2851 1.795768 CAGGCGCAAGAGAAGTACAA 58.204 50.000 10.83 0.0 43.02 2.41
3361 4889 5.221283 ACAACATCATCAAACAACAGCATGA 60.221 36.000 0.00 0.0 39.69 3.07
3566 5096 1.000955 CTGGTTCAGTTGTAGGCGTCT 59.999 52.381 0.00 0.0 0.00 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 9.927668 TGTTTTCTTTCTCTTTCTTTGAACATT 57.072 25.926 0.00 0.0 0.00 2.71
36 37 9.927668 TTGTTTTCTTTCTCTTTCTTTGAACAT 57.072 25.926 0.00 0.0 0.00 2.71
37 38 9.757227 TTTGTTTTCTTTCTCTTTCTTTGAACA 57.243 25.926 0.00 0.0 0.00 3.18
65 66 9.981114 AATTTCTTCTTCATCACCGTTTTTATT 57.019 25.926 0.00 0.0 0.00 1.40
2189 2443 1.134098 CAGTTCTGGAACACCACCTGT 60.134 52.381 14.67 0.0 43.47 4.00
2586 2851 0.811915 CTGGATGAACCTCTCGACGT 59.188 55.000 0.00 0.0 39.86 4.34
3361 4889 8.380099 TCAGTATTTGTAACTATCAAAGGGTGT 58.620 33.333 0.00 0.0 38.02 4.16
3566 5096 2.601067 TACCTCGTCGCCAACCCA 60.601 61.111 0.00 0.0 0.00 4.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.