Multiple sequence alignment - TraesCS2D01G317800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G317800 chr2D 100.000 2598 0 0 1 2598 407223263 407225860 0.000000e+00 4798.0
1 TraesCS2D01G317800 chr2D 80.909 110 17 4 2487 2594 43797987 43798094 1.660000e-12 84.2
2 TraesCS2D01G317800 chr4D 99.497 1392 6 1 1207 2598 329000244 328998854 0.000000e+00 2531.0
3 TraesCS2D01G317800 chr4D 97.633 845 17 3 372 1216 329001269 329000428 0.000000e+00 1447.0
4 TraesCS2D01G317800 chr4D 97.067 375 9 2 1 374 329002778 329002405 4.720000e-177 630.0
5 TraesCS2D01G317800 chr4A 95.495 888 33 5 1227 2109 141124869 141125754 0.000000e+00 1411.0
6 TraesCS2D01G317800 chr4A 89.346 657 52 8 567 1207 141124226 141124880 0.000000e+00 809.0
7 TraesCS2D01G317800 chr4A 93.793 435 13 8 2172 2598 141129953 141130381 2.180000e-180 641.0
8 TraesCS2D01G317800 chr4A 85.948 306 36 6 102 404 5738784 5738483 1.160000e-83 320.0
9 TraesCS2D01G317800 chr1B 98.604 788 10 1 1811 2598 135962055 135962841 0.000000e+00 1393.0
10 TraesCS2D01G317800 chr1B 97.980 594 11 1 1227 1820 135960784 135961376 0.000000e+00 1029.0
11 TraesCS2D01G317800 chr1B 88.403 595 48 8 620 1209 135960219 135960797 0.000000e+00 697.0
12 TraesCS2D01G317800 chr1B 92.453 106 3 2 399 499 135959144 135959249 2.080000e-31 147.0
13 TraesCS2D01G317800 chr1B 96.970 33 1 0 501 533 135960114 135960146 3.610000e-04 56.5
14 TraesCS2D01G317800 chr4B 88.335 823 62 20 1227 2030 408952823 408952016 0.000000e+00 957.0
15 TraesCS2D01G317800 chr4B 87.791 860 52 27 399 1209 408953665 408952810 0.000000e+00 957.0
16 TraesCS2D01G317800 chr4B 89.078 412 26 8 2191 2598 408951805 408951409 6.460000e-136 494.0
17 TraesCS2D01G317800 chr4B 94.595 37 1 1 2139 2175 408951991 408951956 3.610000e-04 56.5
18 TraesCS2D01G317800 chrUn 98.354 486 7 1 1335 1820 377051411 377051895 0.000000e+00 852.0
19 TraesCS2D01G317800 chrUn 98.182 165 2 1 1811 1975 377052961 377053124 1.180000e-73 287.0
20 TraesCS2D01G317800 chrUn 92.453 106 3 2 399 499 326355880 326355985 2.080000e-31 147.0
21 TraesCS2D01G317800 chr7D 86.106 583 52 15 1246 1827 113714995 113715549 3.700000e-168 601.0
22 TraesCS2D01G317800 chr7D 83.364 547 68 15 659 1190 113714445 113714983 3.890000e-133 484.0
23 TraesCS2D01G317800 chr5A 92.611 406 24 5 1 403 615322626 615322224 1.730000e-161 579.0
24 TraesCS2D01G317800 chr7B 84.127 630 64 17 1237 1863 73311617 73312213 6.230000e-161 577.0
25 TraesCS2D01G317800 chr7B 83.784 592 57 20 1235 1817 73335114 73335675 2.290000e-145 525.0
26 TraesCS2D01G317800 chr7B 82.117 548 73 17 659 1191 73328932 73329469 1.830000e-121 446.0
27 TraesCS2D01G317800 chr7A 83.360 631 66 20 1246 1869 118574182 118574780 4.890000e-152 547.0
28 TraesCS2D01G317800 chr7A 82.407 648 73 20 1229 1866 118578769 118579385 6.370000e-146 527.0
29 TraesCS2D01G317800 chr7A 82.267 547 72 17 659 1190 118573634 118574170 1.420000e-122 449.0
30 TraesCS2D01G317800 chr7A 82.516 469 59 14 730 1190 118578311 118578764 8.720000e-105 390.0
31 TraesCS2D01G317800 chr7A 87.213 305 33 6 100 401 80531879 80531578 2.480000e-90 342.0
32 TraesCS2D01G317800 chr7A 86.379 301 31 7 100 397 14176910 14176617 1.160000e-83 320.0
33 TraesCS2D01G317800 chr2B 86.946 406 32 11 1 404 11338054 11337668 1.100000e-118 436.0
34 TraesCS2D01G317800 chr2B 80.734 109 19 2 2487 2594 68422576 68422683 1.660000e-12 84.2
35 TraesCS2D01G317800 chr5D 83.632 391 50 11 812 1190 11009322 11008934 3.180000e-94 355.0
36 TraesCS2D01G317800 chr3A 87.013 308 34 6 100 404 163104528 163104832 2.480000e-90 342.0
37 TraesCS2D01G317800 chr2A 87.171 304 33 5 100 400 735779755 735779455 8.900000e-90 340.0
38 TraesCS2D01G317800 chr5B 86.667 300 37 3 100 397 479636185 479635887 1.930000e-86 329.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G317800 chr2D 407223263 407225860 2597 False 4798.000 4798 100.000000 1 2598 1 chr2D.!!$F2 2597
1 TraesCS2D01G317800 chr4D 328998854 329002778 3924 True 1536.000 2531 98.065667 1 2598 3 chr4D.!!$R1 2597
2 TraesCS2D01G317800 chr4A 141124226 141125754 1528 False 1110.000 1411 92.420500 567 2109 2 chr4A.!!$F2 1542
3 TraesCS2D01G317800 chr1B 135959144 135962841 3697 False 664.500 1393 94.882000 399 2598 5 chr1B.!!$F1 2199
4 TraesCS2D01G317800 chr4B 408951409 408953665 2256 True 616.125 957 89.949750 399 2598 4 chr4B.!!$R1 2199
5 TraesCS2D01G317800 chrUn 377051411 377053124 1713 False 569.500 852 98.268000 1335 1975 2 chrUn.!!$F2 640
6 TraesCS2D01G317800 chr7D 113714445 113715549 1104 False 542.500 601 84.735000 659 1827 2 chr7D.!!$F1 1168
7 TraesCS2D01G317800 chr7B 73311617 73312213 596 False 577.000 577 84.127000 1237 1863 1 chr7B.!!$F1 626
8 TraesCS2D01G317800 chr7B 73335114 73335675 561 False 525.000 525 83.784000 1235 1817 1 chr7B.!!$F3 582
9 TraesCS2D01G317800 chr7B 73328932 73329469 537 False 446.000 446 82.117000 659 1191 1 chr7B.!!$F2 532
10 TraesCS2D01G317800 chr7A 118573634 118579385 5751 False 478.250 547 82.637500 659 1869 4 chr7A.!!$F1 1210

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
991 3059 1.153628 CACCGGTCGTCCTTGATCC 60.154 63.158 2.59 0.0 0.0 3.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2562 10691 1.795768 CAGGCGCAAGAGAAGTACAA 58.204 50.0 10.83 0.0 43.02 2.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
167 168 4.946160 ATTGTGAGGGGGTTTTCTATGA 57.054 40.909 0.00 0.00 0.00 2.15
196 197 2.165641 CGGTCTGCTATGTCACCTAACA 59.834 50.000 0.00 0.00 0.00 2.41
207 208 1.488812 TCACCTAACACCTTGTGCACT 59.511 47.619 19.41 0.00 36.98 4.40
280 281 1.400142 CCATGCGGCTGAATACGAAAA 59.600 47.619 0.00 0.00 0.00 2.29
284 285 2.809119 TGCGGCTGAATACGAAAAGAAA 59.191 40.909 0.00 0.00 0.00 2.52
321 322 3.873801 GCAGGGACAAGTTATGTGACCAT 60.874 47.826 0.00 0.00 44.12 3.55
374 376 4.036262 ACTGAACATTGAGCGCAAGTTTTA 59.964 37.500 11.47 0.54 37.45 1.52
376 378 4.916831 TGAACATTGAGCGCAAGTTTTATG 59.083 37.500 11.47 3.42 37.45 1.90
377 379 4.764679 ACATTGAGCGCAAGTTTTATGA 57.235 36.364 11.47 0.00 37.45 2.15
378 380 4.475944 ACATTGAGCGCAAGTTTTATGAC 58.524 39.130 11.47 0.00 37.45 3.06
379 381 4.216257 ACATTGAGCGCAAGTTTTATGACT 59.784 37.500 11.47 0.00 37.45 3.41
380 382 4.829064 TTGAGCGCAAGTTTTATGACTT 57.171 36.364 11.47 0.00 40.37 3.01
381 383 4.404507 TGAGCGCAAGTTTTATGACTTC 57.595 40.909 11.47 0.00 37.76 3.01
382 384 4.065088 TGAGCGCAAGTTTTATGACTTCT 58.935 39.130 11.47 0.00 37.76 2.85
386 1526 4.790140 GCGCAAGTTTTATGACTTCTGATG 59.210 41.667 0.30 0.00 37.76 3.07
432 1573 1.209621 CGTCCCCCTGGAATCCTAAA 58.790 55.000 0.00 0.00 44.07 1.85
464 1609 5.359716 ACTAGTACAAGAGAGTTCACACG 57.640 43.478 0.00 0.00 0.00 4.49
646 2688 5.017490 AGGAGTCCGTCATTCTTCTTCTTA 58.983 41.667 2.76 0.00 0.00 2.10
757 2804 1.614241 GGGCGAGCTTTCAGACCCTA 61.614 60.000 0.00 0.00 34.34 3.53
762 2809 3.430374 GCGAGCTTTCAGACCCTACAATA 60.430 47.826 0.00 0.00 0.00 1.90
765 2812 6.513180 CGAGCTTTCAGACCCTACAATAATA 58.487 40.000 0.00 0.00 0.00 0.98
991 3059 1.153628 CACCGGTCGTCCTTGATCC 60.154 63.158 2.59 0.00 0.00 3.36
1032 3100 1.194781 ACAGCTGGACCCACGAGATT 61.195 55.000 19.93 0.00 0.00 2.40
1787 8661 8.380099 TCAGTATTTGTAACTATCAAAGGGTGT 58.620 33.333 0.00 0.00 38.02 4.16
2562 10691 0.811915 CTGGATGAACCTCTCGACGT 59.188 55.000 0.00 0.00 39.86 4.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
196 197 1.152756 GGTTGGGAGTGCACAAGGT 60.153 57.895 21.04 0.00 38.28 3.50
207 208 0.692476 CCATCTGTCAGTGGTTGGGA 59.308 55.000 11.32 0.00 0.00 4.37
280 281 1.069500 GCGTGCAAATACGGTGTTTCT 60.069 47.619 0.00 0.00 43.87 2.52
284 285 1.573829 CCTGCGTGCAAATACGGTGT 61.574 55.000 0.00 0.00 43.87 4.16
295 296 0.447801 CATAACTTGTCCCTGCGTGC 59.552 55.000 0.00 0.00 0.00 5.34
374 376 9.607333 TTAGGAGGTAATATCATCAGAAGTCAT 57.393 33.333 0.00 0.00 0.00 3.06
379 381 9.507329 GCAAATTAGGAGGTAATATCATCAGAA 57.493 33.333 0.00 0.00 30.55 3.02
380 382 8.659527 TGCAAATTAGGAGGTAATATCATCAGA 58.340 33.333 0.00 0.00 30.55 3.27
381 383 8.853077 TGCAAATTAGGAGGTAATATCATCAG 57.147 34.615 0.00 0.00 30.55 2.90
382 384 8.439971 ACTGCAAATTAGGAGGTAATATCATCA 58.560 33.333 0.00 0.00 30.55 3.07
397 1537 4.380128 GGGGGACGTTTAACTGCAAATTAG 60.380 45.833 0.00 0.00 0.00 1.73
432 1573 5.183969 TCTCTTGTACTAGTACGCAGTGAT 58.816 41.667 24.36 0.00 45.73 3.06
464 1609 0.309922 CGATCTGGCATGCATGTTCC 59.690 55.000 26.79 20.28 0.00 3.62
646 2688 9.313118 GACAAATTGTTCCAGAATGTTTAGTTT 57.687 29.630 0.00 0.00 0.00 2.66
757 2804 5.163652 GGTCGGCTGAGCTTTTTATTATTGT 60.164 40.000 17.52 0.00 39.53 2.71
762 2809 1.737793 CGGTCGGCTGAGCTTTTTATT 59.262 47.619 21.69 0.00 40.48 1.40
765 2812 1.070786 TCGGTCGGCTGAGCTTTTT 59.929 52.632 21.69 0.00 40.48 1.94
991 3059 1.001764 TGGAGGCCATTGCTGTGAG 60.002 57.895 5.01 0.00 37.74 3.51
1787 8661 5.221283 ACAACATCATCAAACAACAGCATGA 60.221 36.000 0.00 0.00 39.69 3.07
2562 10691 1.795768 CAGGCGCAAGAGAAGTACAA 58.204 50.000 10.83 0.00 43.02 2.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.