Multiple sequence alignment - TraesCS2D01G308400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G308400 chr2D 100.000 2513 0 0 1 2513 395549351 395546839 0 4641
1 TraesCS2D01G308400 chr2D 97.611 1716 23 4 813 2513 552881531 552879819 0 2926
2 TraesCS2D01G308400 chr5D 97.904 2529 32 7 1 2513 543174275 543176798 0 4357
3 TraesCS2D01G308400 chr5D 97.076 2497 36 11 1 2481 448703232 448700757 0 4172
4 TraesCS2D01G308400 chr5D 96.801 2501 41 11 1 2481 115438860 115441341 0 4139
5 TraesCS2D01G308400 chr5D 96.910 1715 33 4 819 2513 406652990 406651276 0 2856
6 TraesCS2D01G308400 chr4D 97.589 2530 41 6 1 2513 9843254 9845780 0 4316
7 TraesCS2D01G308400 chr4D 97.278 2498 46 8 1 2481 403260740 403263232 0 4217
8 TraesCS2D01G308400 chr6D 97.391 2530 44 8 1 2513 77570295 77572819 0 4287
9 TraesCS2D01G308400 chr6D 96.813 1726 28 8 813 2513 102279548 102277825 0 2857
10 TraesCS2D01G308400 chr6D 96.369 1377 29 5 1157 2513 46476800 46478175 0 2246
11 TraesCS2D01G308400 chr1D 97.907 2484 31 7 1 2467 78958016 78960495 0 4279
12 TraesCS2D01G308400 chr1D 97.612 1717 25 2 813 2513 69166204 69164488 0 2929
13 TraesCS2D01G308400 chr3D 97.278 2498 42 10 1 2481 357389677 357392165 0 4213
14 TraesCS2D01G308400 chr7D 97.303 2484 44 9 1 2467 86553898 86556375 0 4194
15 TraesCS2D01G308400 chr7D 96.982 1723 28 7 813 2513 207213027 207211307 0 2872
16 TraesCS2D01G308400 chrUn 97.821 2386 32 5 1 2369 111091637 111089255 0 4100


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G308400 chr2D 395546839 395549351 2512 True 4641 4641 100.000 1 2513 1 chr2D.!!$R1 2512
1 TraesCS2D01G308400 chr2D 552879819 552881531 1712 True 2926 2926 97.611 813 2513 1 chr2D.!!$R2 1700
2 TraesCS2D01G308400 chr5D 543174275 543176798 2523 False 4357 4357 97.904 1 2513 1 chr5D.!!$F2 2512
3 TraesCS2D01G308400 chr5D 448700757 448703232 2475 True 4172 4172 97.076 1 2481 1 chr5D.!!$R2 2480
4 TraesCS2D01G308400 chr5D 115438860 115441341 2481 False 4139 4139 96.801 1 2481 1 chr5D.!!$F1 2480
5 TraesCS2D01G308400 chr5D 406651276 406652990 1714 True 2856 2856 96.910 819 2513 1 chr5D.!!$R1 1694
6 TraesCS2D01G308400 chr4D 9843254 9845780 2526 False 4316 4316 97.589 1 2513 1 chr4D.!!$F1 2512
7 TraesCS2D01G308400 chr4D 403260740 403263232 2492 False 4217 4217 97.278 1 2481 1 chr4D.!!$F2 2480
8 TraesCS2D01G308400 chr6D 77570295 77572819 2524 False 4287 4287 97.391 1 2513 1 chr6D.!!$F2 2512
9 TraesCS2D01G308400 chr6D 102277825 102279548 1723 True 2857 2857 96.813 813 2513 1 chr6D.!!$R1 1700
10 TraesCS2D01G308400 chr6D 46476800 46478175 1375 False 2246 2246 96.369 1157 2513 1 chr6D.!!$F1 1356
11 TraesCS2D01G308400 chr1D 78958016 78960495 2479 False 4279 4279 97.907 1 2467 1 chr1D.!!$F1 2466
12 TraesCS2D01G308400 chr1D 69164488 69166204 1716 True 2929 2929 97.612 813 2513 1 chr1D.!!$R1 1700
13 TraesCS2D01G308400 chr3D 357389677 357392165 2488 False 4213 4213 97.278 1 2481 1 chr3D.!!$F1 2480
14 TraesCS2D01G308400 chr7D 86553898 86556375 2477 False 4194 4194 97.303 1 2467 1 chr7D.!!$F1 2466
15 TraesCS2D01G308400 chr7D 207211307 207213027 1720 True 2872 2872 96.982 813 2513 1 chr7D.!!$R1 1700
16 TraesCS2D01G308400 chrUn 111089255 111091637 2382 True 4100 4100 97.821 1 2369 1 chrUn.!!$R1 2368

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
863 872 2.08532 TCTCGTTCTTCTTCCTCTCGG 58.915 52.381 0.0 0.0 0.0 4.63 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2374 2423 3.823281 TTGTCCCAAGTTTAGACACGA 57.177 42.857 4.56 0.0 40.1 4.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
396 404 5.895534 TGGTAACTAGGTCTCATAAACGGAT 59.104 40.000 0.00 0.00 37.61 4.18
863 872 2.085320 TCTCGTTCTTCTTCCTCTCGG 58.915 52.381 0.00 0.00 0.00 4.63
909 918 5.337169 CCATCTTCTCGTTCTTCTTCCTCTT 60.337 44.000 0.00 0.00 0.00 2.85
935 944 4.764308 GCAATTCCTCTGTTTCTTCCTCTT 59.236 41.667 0.00 0.00 0.00 2.85
1025 1034 1.002868 GATGCACTGACTGCCCACT 60.003 57.895 0.00 0.00 46.51 4.00
1038 1047 2.656646 CCACTGACTGCGCCACTA 59.343 61.111 4.18 0.00 0.00 2.74
1488 1501 9.975218 TTAGGAATACTTGCTCTAGGAATTTTT 57.025 29.630 0.00 0.00 31.99 1.94
1592 1621 2.030213 GCAACTGTCGATCTCTGAATGC 59.970 50.000 0.00 2.46 0.00 3.56
1807 1836 3.175109 ACTTTTGTCCTCGAGTTCGTT 57.825 42.857 12.31 0.00 40.80 3.85
2374 2423 6.014070 GGTTAATTTTCCCCACACCAATTAGT 60.014 38.462 0.00 0.00 0.00 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
178 182 6.068010 ACTTGGTGTAGGTCATTTTCATGAA 58.932 36.000 3.38 3.38 41.30 2.57
863 872 3.056536 GGGAAAGAAACAGAGGAATTGCC 60.057 47.826 0.00 0.00 0.00 4.52
909 918 4.074970 GGAAGAAACAGAGGAATTGCTCA 58.925 43.478 26.36 0.00 0.00 4.26
1025 1034 2.027073 CGCTTTAGTGGCGCAGTCA 61.027 57.895 10.83 0.00 43.93 3.41
1038 1047 1.202604 TCCTTCGAAGTCAACCGCTTT 60.203 47.619 23.03 0.00 0.00 3.51
1488 1501 2.766263 ACGAGAGATGGCCATCAAGTAA 59.234 45.455 40.05 2.59 40.22 2.24
1807 1836 5.392811 GCGAACTAGGTTTCTAGCAGAACTA 60.393 44.000 0.00 0.00 45.20 2.24
2179 2226 5.049405 ACTTTGAGATGTTTGGCTTTAGTCG 60.049 40.000 0.00 0.00 0.00 4.18
2374 2423 3.823281 TTGTCCCAAGTTTAGACACGA 57.177 42.857 4.56 0.00 40.10 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.