Multiple sequence alignment - TraesCS2D01G295400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G295400 chr2D 100.000 2363 0 0 1 2363 377260142 377262504 0.000000e+00 4364.0
1 TraesCS2D01G295400 chr2D 96.109 951 22 4 876 1813 578032569 578031621 0.000000e+00 1537.0
2 TraesCS2D01G295400 chr2D 92.754 759 39 3 1 746 407932983 407933738 0.000000e+00 1083.0
3 TraesCS2D01G295400 chr2D 98.201 556 10 0 1808 2363 578031588 578031033 0.000000e+00 972.0
4 TraesCS2D01G295400 chr7D 97.292 1625 32 10 745 2363 553413856 553412238 0.000000e+00 2747.0
5 TraesCS2D01G295400 chr7D 93.140 758 34 5 3 746 117413880 117413127 0.000000e+00 1096.0
6 TraesCS2D01G295400 chr7D 92.819 752 42 7 3 746 42338790 42338043 0.000000e+00 1079.0
7 TraesCS2D01G295400 chr7D 95.349 43 2 0 740 782 607893807 607893765 4.210000e-08 69.4
8 TraesCS2D01G295400 chr7D 95.349 43 2 0 740 782 607894350 607894308 4.210000e-08 69.4
9 TraesCS2D01G295400 chr7D 95.349 43 2 0 740 782 608632772 608632730 4.210000e-08 69.4
10 TraesCS2D01G295400 chr7D 95.349 43 2 0 740 782 608634030 608633988 4.210000e-08 69.4
11 TraesCS2D01G295400 chr3D 97.854 1491 13 3 873 2363 67055489 67056960 0.000000e+00 2558.0
12 TraesCS2D01G295400 chr5B 91.626 1230 32 16 946 2137 17599174 17600370 0.000000e+00 1635.0
13 TraesCS2D01G295400 chr5B 94.235 902 30 5 927 1813 386862534 386861640 0.000000e+00 1358.0
14 TraesCS2D01G295400 chr5B 97.842 556 12 0 1808 2363 386861607 386861052 0.000000e+00 961.0
15 TraesCS2D01G295400 chr5B 93.548 93 5 1 873 965 17592131 17592222 1.140000e-28 137.0
16 TraesCS2D01G295400 chr2A 93.602 969 29 11 842 1795 2613282 2614232 0.000000e+00 1415.0
17 TraesCS2D01G295400 chr2A 93.750 752 36 4 3 746 617013075 617012327 0.000000e+00 1118.0
18 TraesCS2D01G295400 chr1B 94.568 902 29 3 927 1813 80959105 80960001 0.000000e+00 1376.0
19 TraesCS2D01G295400 chr1B 92.554 967 40 4 873 1813 46930231 46931191 0.000000e+00 1358.0
20 TraesCS2D01G295400 chr1B 98.022 556 10 1 1808 2363 46931224 46931778 0.000000e+00 965.0
21 TraesCS2D01G295400 chr1B 97.842 556 12 0 1808 2363 80960034 80960589 0.000000e+00 961.0
22 TraesCS2D01G295400 chr1B 95.691 557 21 3 1808 2363 321234550 321233996 0.000000e+00 893.0
23 TraesCS2D01G295400 chr1B 95.652 460 11 1 1363 1813 321235042 321234583 0.000000e+00 730.0
24 TraesCS2D01G295400 chr3B 91.706 856 40 10 873 1713 59224698 59225537 0.000000e+00 1158.0
25 TraesCS2D01G295400 chr3B 92.734 757 41 6 1 746 728236262 728235509 0.000000e+00 1081.0
26 TraesCS2D01G295400 chr3B 97.842 556 12 0 1808 2363 59228075 59228630 0.000000e+00 961.0
27 TraesCS2D01G295400 chr7B 94.489 744 27 2 1079 1813 108526127 108526865 0.000000e+00 1134.0
28 TraesCS2D01G295400 chr7B 97.842 556 12 0 1808 2363 108526898 108527453 0.000000e+00 961.0
29 TraesCS2D01G295400 chr7B 95.349 43 2 0 740 782 696927533 696927491 4.210000e-08 69.4
30 TraesCS2D01G295400 chr7B 97.500 40 1 0 740 779 697780725 697780764 4.210000e-08 69.4
31 TraesCS2D01G295400 chr3A 93.493 753 38 5 1 746 611214781 611215529 0.000000e+00 1109.0
32 TraesCS2D01G295400 chr3A 93.218 752 42 3 1 746 685211145 685210397 0.000000e+00 1098.0
33 TraesCS2D01G295400 chr1A 93.103 754 40 5 1 746 156850623 156849874 0.000000e+00 1094.0
34 TraesCS2D01G295400 chr4D 93.057 749 38 6 3 746 360999071 360998332 0.000000e+00 1083.0
35 TraesCS2D01G295400 chr7A 83.824 136 17 3 1251 1385 188901991 188901860 8.870000e-25 124.0
36 TraesCS2D01G295400 chr4A 87.500 72 7 2 745 815 673051295 673051365 5.410000e-12 82.4
37 TraesCS2D01G295400 chr6A 90.196 51 4 1 730 779 27631373 27631323 5.450000e-07 65.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G295400 chr2D 377260142 377262504 2362 False 4364.0 4364 100.0000 1 2363 1 chr2D.!!$F1 2362
1 TraesCS2D01G295400 chr2D 578031033 578032569 1536 True 1254.5 1537 97.1550 876 2363 2 chr2D.!!$R1 1487
2 TraesCS2D01G295400 chr2D 407932983 407933738 755 False 1083.0 1083 92.7540 1 746 1 chr2D.!!$F2 745
3 TraesCS2D01G295400 chr7D 553412238 553413856 1618 True 2747.0 2747 97.2920 745 2363 1 chr7D.!!$R3 1618
4 TraesCS2D01G295400 chr7D 117413127 117413880 753 True 1096.0 1096 93.1400 3 746 1 chr7D.!!$R2 743
5 TraesCS2D01G295400 chr7D 42338043 42338790 747 True 1079.0 1079 92.8190 3 746 1 chr7D.!!$R1 743
6 TraesCS2D01G295400 chr3D 67055489 67056960 1471 False 2558.0 2558 97.8540 873 2363 1 chr3D.!!$F1 1490
7 TraesCS2D01G295400 chr5B 17599174 17600370 1196 False 1635.0 1635 91.6260 946 2137 1 chr5B.!!$F2 1191
8 TraesCS2D01G295400 chr5B 386861052 386862534 1482 True 1159.5 1358 96.0385 927 2363 2 chr5B.!!$R1 1436
9 TraesCS2D01G295400 chr2A 2613282 2614232 950 False 1415.0 1415 93.6020 842 1795 1 chr2A.!!$F1 953
10 TraesCS2D01G295400 chr2A 617012327 617013075 748 True 1118.0 1118 93.7500 3 746 1 chr2A.!!$R1 743
11 TraesCS2D01G295400 chr1B 80959105 80960589 1484 False 1168.5 1376 96.2050 927 2363 2 chr1B.!!$F2 1436
12 TraesCS2D01G295400 chr1B 46930231 46931778 1547 False 1161.5 1358 95.2880 873 2363 2 chr1B.!!$F1 1490
13 TraesCS2D01G295400 chr1B 321233996 321235042 1046 True 811.5 893 95.6715 1363 2363 2 chr1B.!!$R1 1000
14 TraesCS2D01G295400 chr3B 728235509 728236262 753 True 1081.0 1081 92.7340 1 746 1 chr3B.!!$R1 745
15 TraesCS2D01G295400 chr3B 59224698 59228630 3932 False 1059.5 1158 94.7740 873 2363 2 chr3B.!!$F1 1490
16 TraesCS2D01G295400 chr7B 108526127 108527453 1326 False 1047.5 1134 96.1655 1079 2363 2 chr7B.!!$F2 1284
17 TraesCS2D01G295400 chr3A 611214781 611215529 748 False 1109.0 1109 93.4930 1 746 1 chr3A.!!$F1 745
18 TraesCS2D01G295400 chr3A 685210397 685211145 748 True 1098.0 1098 93.2180 1 746 1 chr3A.!!$R1 745
19 TraesCS2D01G295400 chr1A 156849874 156850623 749 True 1094.0 1094 93.1030 1 746 1 chr1A.!!$R1 745
20 TraesCS2D01G295400 chr4D 360998332 360999071 739 True 1083.0 1083 93.0570 3 746 1 chr4D.!!$R1 743

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
24 25 1.671261 CCGCTGTCCAAGAAGAGACTG 60.671 57.143 0.0 0.0 35.67 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1501 1579 1.020333 CGACGAAGGAGAGAGGACGT 61.02 60.0 0.0 0.0 36.71 4.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 1.671261 CCGCTGTCCAAGAAGAGACTG 60.671 57.143 0.00 0.0 35.67 3.51
94 95 5.126707 GCTCATTGGATGAAAAAGATGAGGT 59.873 40.000 11.69 0.0 40.31 3.85
102 103 3.072915 TGAAAAAGATGAGGTGGAGAGCA 59.927 43.478 0.00 0.0 0.00 4.26
125 126 2.368875 AGAACAAAAGGAGGAAGAGCGA 59.631 45.455 0.00 0.0 0.00 4.93
137 138 2.632377 GAAGAGCGAATTGATCACCCA 58.368 47.619 0.00 0.0 34.70 4.51
202 203 7.775053 TGTTTAATTTCCCTTCATGCTTACT 57.225 32.000 0.00 0.0 0.00 2.24
205 206 7.630242 TTAATTTCCCTTCATGCTTACTGAG 57.370 36.000 0.00 0.0 0.00 3.35
390 396 5.955959 ACCCACGCATGATAGTCCTATTATA 59.044 40.000 0.00 0.0 0.00 0.98
672 691 6.191315 TGCATAGGAAGAGAGTTAGACTTCT 58.809 40.000 0.00 0.0 39.61 2.85
815 834 6.073657 CGACTGGTTTATTTTCGACAGGTTTA 60.074 38.462 0.00 0.0 0.00 2.01
816 835 7.360607 CGACTGGTTTATTTTCGACAGGTTTAT 60.361 37.037 0.00 0.0 0.00 1.40
817 836 8.173542 ACTGGTTTATTTTCGACAGGTTTATT 57.826 30.769 0.00 0.0 0.00 1.40
818 837 8.635328 ACTGGTTTATTTTCGACAGGTTTATTT 58.365 29.630 0.00 0.0 0.00 1.40
819 838 9.471084 CTGGTTTATTTTCGACAGGTTTATTTT 57.529 29.630 0.00 0.0 0.00 1.82
820 839 9.465985 TGGTTTATTTTCGACAGGTTTATTTTC 57.534 29.630 0.00 0.0 0.00 2.29
821 840 8.632551 GGTTTATTTTCGACAGGTTTATTTTCG 58.367 33.333 0.00 0.0 0.00 3.46
822 841 9.384682 GTTTATTTTCGACAGGTTTATTTTCGA 57.615 29.630 0.00 0.0 36.95 3.71
823 842 8.938047 TTATTTTCGACAGGTTTATTTTCGAC 57.062 30.769 0.00 0.0 38.37 4.20
824 843 5.987777 TTTCGACAGGTTTATTTTCGACA 57.012 34.783 0.00 0.0 38.37 4.35
825 844 5.585500 TTCGACAGGTTTATTTTCGACAG 57.415 39.130 0.00 0.0 38.37 3.51
826 845 3.991773 TCGACAGGTTTATTTTCGACAGG 59.008 43.478 0.00 0.0 33.95 4.00
827 846 3.744426 CGACAGGTTTATTTTCGACAGGT 59.256 43.478 0.00 0.0 0.00 4.00
828 847 4.212636 CGACAGGTTTATTTTCGACAGGTT 59.787 41.667 0.00 0.0 0.00 3.50
829 848 5.277634 CGACAGGTTTATTTTCGACAGGTTT 60.278 40.000 0.00 0.0 0.00 3.27
830 849 6.459670 ACAGGTTTATTTTCGACAGGTTTT 57.540 33.333 0.00 0.0 0.00 2.43
864 883 3.594603 TTTTCGTCATCCTCTCACCTC 57.405 47.619 0.00 0.0 0.00 3.85
881 900 2.678934 CCCCCGGTCGACTGAAGA 60.679 66.667 26.01 0.0 0.00 2.87
1168 1237 2.853542 TTGCAGGCCTCCAGGTCA 60.854 61.111 0.00 0.0 43.78 4.02
1268 1337 0.246635 CAACGACCCGGAAGACATCT 59.753 55.000 0.73 0.0 0.00 2.90
1539 1617 2.354729 CCATGGCCTCCGAACCAA 59.645 61.111 3.32 0.0 39.96 3.67
1943 4473 7.446931 TGTTACAATCCATTCTGAAGCAAACTA 59.553 33.333 0.00 0.0 0.00 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 7.220030 TCTTCCATAGACTCCTGCAAAATATC 58.780 38.462 0.00 0.00 0.00 1.63
94 95 3.885297 CTCCTTTTGTTCTTTGCTCTCCA 59.115 43.478 0.00 0.00 0.00 3.86
102 103 3.565902 CGCTCTTCCTCCTTTTGTTCTTT 59.434 43.478 0.00 0.00 0.00 2.52
125 126 1.488390 GTGGGCATGGGTGATCAATT 58.512 50.000 0.00 0.00 0.00 2.32
137 138 3.118531 ACTCTCATTAGAAGGTGGGCAT 58.881 45.455 0.00 0.00 0.00 4.40
202 203 5.774102 ATCATCATAGCAATCATCCCTCA 57.226 39.130 0.00 0.00 0.00 3.86
205 206 6.585695 AACAATCATCATAGCAATCATCCC 57.414 37.500 0.00 0.00 0.00 3.85
390 396 6.238648 AGTGTAGTCGGGAGAATTCAAAAAT 58.761 36.000 8.44 0.00 42.89 1.82
852 871 2.283809 CGGGGGAGGTGAGAGGAT 59.716 66.667 0.00 0.00 0.00 3.24
864 883 2.678934 TCTTCAGTCGACCGGGGG 60.679 66.667 13.01 0.00 0.00 5.40
881 900 3.599343 GTTTATTTTCGTACGAGGGGGT 58.401 45.455 18.64 6.96 0.00 4.95
1501 1579 1.020333 CGACGAAGGAGAGAGGACGT 61.020 60.000 0.00 0.00 36.71 4.34
1943 4473 9.780186 AACATCTTCTTAAACTGCTAGTAACTT 57.220 29.630 0.00 0.00 0.00 2.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.