Multiple sequence alignment - TraesCS2D01G282400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G282400 chr2D 100.000 2519 0 0 1 2519 355445676 355443158 0 4652
1 TraesCS2D01G282400 chr6D 97.501 2521 59 3 1 2519 464545449 464547967 0 4303
2 TraesCS2D01G282400 chr5B 95.051 2526 99 14 1 2519 697910857 697908351 0 3949
3 TraesCS2D01G282400 chr5B 94.304 2528 116 14 1 2519 701869129 701866621 0 3845
4 TraesCS2D01G282400 chr3B 94.616 2526 108 14 1 2519 637643462 637640958 0 3886
5 TraesCS2D01G282400 chr3B 96.517 1809 55 7 1 1806 749482511 749480708 0 2985
6 TraesCS2D01G282400 chr3B 93.593 1748 87 12 780 2519 1649918 1651648 0 2584
7 TraesCS2D01G282400 chr3B 95.559 698 26 5 1801 2493 749360573 749359876 0 1112
8 TraesCS2D01G282400 chrUn 94.185 2528 118 15 1 2519 8324585 8322078 0 3827
9 TraesCS2D01G282400 chr2B 93.755 2530 128 18 1 2519 731624895 731622385 0 3770
10 TraesCS2D01G282400 chr1B 93.676 2530 131 17 1 2519 603224524 603227035 0 3759
11 TraesCS2D01G282400 chr1B 95.504 2313 76 13 1 2303 39833636 39835930 0 3670
12 TraesCS2D01G282400 chr1B 95.133 1089 41 7 1441 2519 18295212 18294126 0 1707


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G282400 chr2D 355443158 355445676 2518 True 4652 4652 100.000 1 2519 1 chr2D.!!$R1 2518
1 TraesCS2D01G282400 chr6D 464545449 464547967 2518 False 4303 4303 97.501 1 2519 1 chr6D.!!$F1 2518
2 TraesCS2D01G282400 chr5B 697908351 697910857 2506 True 3949 3949 95.051 1 2519 1 chr5B.!!$R1 2518
3 TraesCS2D01G282400 chr5B 701866621 701869129 2508 True 3845 3845 94.304 1 2519 1 chr5B.!!$R2 2518
4 TraesCS2D01G282400 chr3B 637640958 637643462 2504 True 3886 3886 94.616 1 2519 1 chr3B.!!$R1 2518
5 TraesCS2D01G282400 chr3B 749480708 749482511 1803 True 2985 2985 96.517 1 1806 1 chr3B.!!$R3 1805
6 TraesCS2D01G282400 chr3B 1649918 1651648 1730 False 2584 2584 93.593 780 2519 1 chr3B.!!$F1 1739
7 TraesCS2D01G282400 chr3B 749359876 749360573 697 True 1112 1112 95.559 1801 2493 1 chr3B.!!$R2 692
8 TraesCS2D01G282400 chrUn 8322078 8324585 2507 True 3827 3827 94.185 1 2519 1 chrUn.!!$R1 2518
9 TraesCS2D01G282400 chr2B 731622385 731624895 2510 True 3770 3770 93.755 1 2519 1 chr2B.!!$R1 2518
10 TraesCS2D01G282400 chr1B 603224524 603227035 2511 False 3759 3759 93.676 1 2519 1 chr1B.!!$F2 2518
11 TraesCS2D01G282400 chr1B 39833636 39835930 2294 False 3670 3670 95.504 1 2303 1 chr1B.!!$F1 2302
12 TraesCS2D01G282400 chr1B 18294126 18295212 1086 True 1707 1707 95.133 1441 2519 1 chr1B.!!$R1 1078

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
738 745 0.253044 TAAGCAAGGCCACTAGCAGG 59.747 55.0 5.01 0.0 46.5 4.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2299 2356 0.380378 TTCTGCGCACACCAAAAGAC 59.62 50.0 5.66 0.0 0.0 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
428 432 3.198068 ACTATGATTGGCTACAAGCGTG 58.802 45.455 0.00 0.00 45.62 5.34
492 496 3.748083 ACATAGATAGCAATGCCAGTGG 58.252 45.455 4.20 4.20 0.00 4.00
738 745 0.253044 TAAGCAAGGCCACTAGCAGG 59.747 55.000 5.01 0.00 46.50 4.85
851 859 9.463443 GCTAATTTCTGTCACACAAAGTTTAAT 57.537 29.630 0.00 0.00 0.00 1.40
890 899 0.981183 TTGTAGGGTCGCAGGAACAT 59.019 50.000 0.00 0.00 0.00 2.71
970 979 7.284034 AGGACGAGGTAATTCGAATAGAGTTTA 59.716 37.037 11.83 0.00 43.03 2.01
979 988 5.502153 TCGAATAGAGTTTAGAGGTCTGC 57.498 43.478 0.00 0.00 0.00 4.26
1071 1081 2.061848 TCCCAACTTGTCATCCCAGAA 58.938 47.619 0.00 0.00 0.00 3.02
1109 1119 2.511659 AGATGCAGCAAGTGTTCACAT 58.488 42.857 4.07 0.00 0.00 3.21
1616 1631 0.608130 CCTGGACTCGTTGGATGTGA 59.392 55.000 0.00 0.00 0.00 3.58
1667 1682 2.356135 CGTCGGTTTGGGATTCTGATT 58.644 47.619 0.00 0.00 0.00 2.57
1882 1920 4.142004 ACACTATCCTTAACTAGGCAACCG 60.142 45.833 0.00 0.00 44.37 4.44
2050 2089 4.174762 GAGTAGAGAAAGTTGCTTACCCG 58.825 47.826 0.00 0.00 0.00 5.28
2282 2327 6.718388 TGTACCTGTTCTAATATACGTGACG 58.282 40.000 2.24 2.24 0.00 4.35
2299 2356 0.534412 ACGCCAATGTCCTCTCTCTG 59.466 55.000 0.00 0.00 0.00 3.35
2334 2391 3.859386 CGCAGAAACAAAAGAAGCTTGTT 59.141 39.130 2.10 2.27 46.37 2.83
2369 2426 9.110617 GCATGAAATATGTTCTGAAATATCACG 57.889 33.333 0.00 0.00 0.00 4.35
2407 2464 3.439129 CGTACAGGGAATTGGGAAACTTC 59.561 47.826 0.00 0.00 0.00 3.01
2463 2520 1.873591 GACAATGTTGCTCGTCCAAGT 59.126 47.619 0.00 0.00 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
172 175 5.532779 TGGACACTGCAAACACATAATACAA 59.467 36.000 0.00 0.00 0.00 2.41
428 432 5.399013 ACAAATTATTCCTTTAGTGCGCAC 58.601 37.500 32.79 32.79 0.00 5.34
492 496 4.880120 TGCCTTCTGAATCATCATCTTGTC 59.120 41.667 0.00 0.00 34.37 3.18
738 745 9.118236 GTTCTTATAACTTCAACATGCTCAAAC 57.882 33.333 0.00 0.00 0.00 2.93
970 979 0.392729 GCAATCTGCAGCAGACCTCT 60.393 55.000 27.73 8.96 43.63 3.69
1071 1081 2.562296 TCTACTGGAATCTTGCCCCTT 58.438 47.619 0.00 0.00 0.00 3.95
1109 1119 1.638070 TGTTTGGCAGACCCCATATCA 59.362 47.619 5.64 0.00 34.21 2.15
1667 1682 9.020731 GTCCTTCTTAATGACCTTGGAAATAAA 57.979 33.333 0.00 0.00 0.00 1.40
1882 1920 5.175673 GTGAGTTGCTTAGGAACAAAAATGC 59.824 40.000 18.23 0.52 0.00 3.56
2082 2125 7.293402 TGAAGTGTGAGAAAAATGCAAAAAG 57.707 32.000 0.00 0.00 0.00 2.27
2084 2127 7.387397 AGTTTGAAGTGTGAGAAAAATGCAAAA 59.613 29.630 0.00 0.00 0.00 2.44
2282 2327 1.830477 AGACAGAGAGAGGACATTGGC 59.170 52.381 0.00 0.00 0.00 4.52
2299 2356 0.380378 TTCTGCGCACACCAAAAGAC 59.620 50.000 5.66 0.00 0.00 3.01
2334 2391 3.913509 ACATATTTCATGCACCATCCCA 58.086 40.909 0.00 0.00 0.00 4.37
2369 2426 0.744414 TACGAGCTTGCCCATTGAGC 60.744 55.000 0.00 0.00 36.68 4.26
2463 2520 4.079253 GCCTTTCCCTTGAATGTTCACTA 58.921 43.478 0.00 0.00 36.83 2.74
2494 2551 2.351276 GCGGGGGTCATTCACACT 59.649 61.111 0.00 0.00 0.00 3.55


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.