Multiple sequence alignment - TraesCS2D01G275800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G275800 chr2D 100.000 3662 0 0 1 3662 345274982 345271321 0.000000e+00 6763.0
1 TraesCS2D01G275800 chr2D 97.873 3667 63 7 1 3662 639464302 639467958 0.000000e+00 6325.0
2 TraesCS2D01G275800 chr7D 98.582 3667 47 1 1 3662 58108629 58112295 0.000000e+00 6479.0
3 TraesCS2D01G275800 chr7D 96.483 3668 120 5 1 3662 127416964 127413300 0.000000e+00 6050.0
4 TraesCS2D01G275800 chr1D 98.173 3667 62 1 1 3662 71308016 71304350 0.000000e+00 6396.0
5 TraesCS2D01G275800 chr2A 92.513 3673 248 12 1 3662 32135383 32131727 0.000000e+00 5234.0
6 TraesCS2D01G275800 chr1A 93.081 3165 204 11 1 3155 546526287 546523128 0.000000e+00 4617.0
7 TraesCS2D01G275800 chr1A 78.105 1087 200 28 193 1261 10588701 10587635 0.000000e+00 654.0
8 TraesCS2D01G275800 chr5D 98.701 2078 27 0 1 2078 42224958 42222881 0.000000e+00 3688.0
9 TraesCS2D01G275800 chr5D 97.262 1461 34 2 2207 3662 42222895 42221436 0.000000e+00 2471.0
10 TraesCS2D01G275800 chr4D 78.962 1445 266 30 1 1423 508533515 508532087 0.000000e+00 950.0
11 TraesCS2D01G275800 chr7B 91.579 95 8 0 1 95 558313635 558313541 8.250000e-27 132.0
12 TraesCS2D01G275800 chr7B 73.864 176 42 4 1235 1408 718427411 718427238 2.360000e-07 67.6
13 TraesCS2D01G275800 chr6A 90.426 94 9 0 1 94 494044335 494044428 1.380000e-24 124.0
14 TraesCS2D01G275800 chr4A 75.568 176 39 4 1235 1408 117097665 117097492 2.340000e-12 84.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G275800 chr2D 345271321 345274982 3661 True 6763.0 6763 100.0000 1 3662 1 chr2D.!!$R1 3661
1 TraesCS2D01G275800 chr2D 639464302 639467958 3656 False 6325.0 6325 97.8730 1 3662 1 chr2D.!!$F1 3661
2 TraesCS2D01G275800 chr7D 58108629 58112295 3666 False 6479.0 6479 98.5820 1 3662 1 chr7D.!!$F1 3661
3 TraesCS2D01G275800 chr7D 127413300 127416964 3664 True 6050.0 6050 96.4830 1 3662 1 chr7D.!!$R1 3661
4 TraesCS2D01G275800 chr1D 71304350 71308016 3666 True 6396.0 6396 98.1730 1 3662 1 chr1D.!!$R1 3661
5 TraesCS2D01G275800 chr2A 32131727 32135383 3656 True 5234.0 5234 92.5130 1 3662 1 chr2A.!!$R1 3661
6 TraesCS2D01G275800 chr1A 546523128 546526287 3159 True 4617.0 4617 93.0810 1 3155 1 chr1A.!!$R2 3154
7 TraesCS2D01G275800 chr1A 10587635 10588701 1066 True 654.0 654 78.1050 193 1261 1 chr1A.!!$R1 1068
8 TraesCS2D01G275800 chr5D 42221436 42224958 3522 True 3079.5 3688 97.9815 1 3662 2 chr5D.!!$R1 3661
9 TraesCS2D01G275800 chr4D 508532087 508533515 1428 True 950.0 950 78.9620 1 1423 1 chr4D.!!$R1 1422

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
95 96 4.486125 TGCATGCAGGAGATAGTTTGTA 57.514 40.909 18.46 0.0 0.0 2.41 F
121 122 6.822667 TGTTCGGTGAGTAGTCATTTACTA 57.177 37.500 2.99 0.0 39.8 1.82 F
1788 1843 1.075542 CGGCAATTTCGAGCACACTA 58.924 50.000 0.00 0.0 0.0 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1241 1296 2.420129 GGCTTCGCCCATTTCTCTCTTA 60.420 50.000 0.00 0.00 44.06 2.10 R
2060 2115 3.340928 CTCATGACTTCAAGTGCATGGA 58.659 45.455 20.62 11.96 35.93 3.41 R
3020 3081 4.664677 ACGGGAGTGCTGCACGAC 62.665 66.667 25.39 21.79 44.82 4.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
95 96 4.486125 TGCATGCAGGAGATAGTTTGTA 57.514 40.909 18.46 0.00 0.00 2.41
121 122 6.822667 TGTTCGGTGAGTAGTCATTTACTA 57.177 37.500 2.99 0.00 39.80 1.82
126 129 7.052248 TCGGTGAGTAGTCATTTACTATCTCA 58.948 38.462 2.99 10.61 42.63 3.27
1518 1573 9.842775 ATGTCATCTTCATAATACAATGTCTGT 57.157 29.630 0.00 0.00 42.47 3.41
1788 1843 1.075542 CGGCAATTTCGAGCACACTA 58.924 50.000 0.00 0.00 0.00 2.74
2060 2115 9.458727 AACATTCAGACATTCAAATCTCTACAT 57.541 29.630 0.00 0.00 0.00 2.29
2077 2132 3.144657 ACATCCATGCACTTGAAGTCA 57.855 42.857 0.00 0.00 0.00 3.41
2151 2206 6.484643 TGCTCAAGATAACAATGGATAAGCTC 59.515 38.462 0.00 0.00 0.00 4.09
2180 2235 2.358615 TGCTGTCCGTGATGGCAC 60.359 61.111 0.00 0.00 41.67 5.01
2298 2353 4.168760 GCAGTGCTATTGGTGATTTTGTC 58.831 43.478 8.18 0.00 0.00 3.18
2562 2617 0.038343 AATGCTCAAATTGCGGCGTT 60.038 45.000 9.37 10.59 0.00 4.84
3020 3081 2.403252 AAAGACCGATACCTTGCCTG 57.597 50.000 0.00 0.00 0.00 4.85
3281 3343 2.876550 AGTGATCCGCATCATGATGTTG 59.123 45.455 31.09 24.05 41.26 3.33
3510 3572 2.765807 AGCTGTCGAGGGGATGGG 60.766 66.667 0.00 0.00 0.00 4.00
3636 3698 2.102357 CGACGATGGCGCTACACT 59.898 61.111 7.64 0.00 42.48 3.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
95 96 5.407407 AAATGACTACTCACCGAACATCT 57.593 39.130 0.00 0.00 0.00 2.90
297 307 2.303890 AGAGCATGGTTGTGATCTGTCA 59.696 45.455 0.00 0.00 42.75 3.58
400 410 4.800993 CCAACGCTAATGTTGTTTTCACAA 59.199 37.500 5.96 0.00 46.08 3.33
401 411 4.355437 CCAACGCTAATGTTGTTTTCACA 58.645 39.130 5.96 0.00 46.08 3.58
1241 1296 2.420129 GGCTTCGCCCATTTCTCTCTTA 60.420 50.000 0.00 0.00 44.06 2.10
1788 1843 3.729489 ATGGCAGCAGAGCAGGCT 61.729 61.111 9.16 0.00 40.88 4.58
2060 2115 3.340928 CTCATGACTTCAAGTGCATGGA 58.659 45.455 20.62 11.96 35.93 3.41
2077 2132 3.437052 GGATTTGCATCCCCTAACCTCAT 60.437 47.826 0.00 0.00 43.29 2.90
2151 2206 0.108424 GGACAGCAGCTACAGGAGTG 60.108 60.000 0.00 0.00 0.00 3.51
2180 2235 0.900647 AGTTCTGTCCTCCAGTCCCG 60.901 60.000 0.00 0.00 42.19 5.14
2185 2240 0.108898 CGCTGAGTTCTGTCCTCCAG 60.109 60.000 0.00 0.00 42.97 3.86
2298 2353 1.856265 GCTCTGGTGCTTTCAACCCG 61.856 60.000 0.00 0.00 0.00 5.28
2562 2617 1.004277 GTGTTTCTCCTATGGCCACCA 59.996 52.381 8.16 0.00 38.19 4.17
2994 3055 4.807834 GCAAGGTATCGGTCTTTAAGTACC 59.192 45.833 1.80 1.80 33.47 3.34
3020 3081 4.664677 ACGGGAGTGCTGCACGAC 62.665 66.667 25.39 21.79 44.82 4.34
3510 3572 8.668510 AACATGTTCTTCTGGATCATATGTAC 57.331 34.615 4.92 0.00 33.91 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.