Multiple sequence alignment - TraesCS2D01G271100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G271100 chr2D 100.000 2327 0 0 1 2327 334230605 334228279 0.000000e+00 4298
1 TraesCS2D01G271100 chr5D 97.167 2330 35 4 1 2327 240135817 240133516 0.000000e+00 3908
2 TraesCS2D01G271100 chr5D 96.565 2329 45 8 1 2327 6203165 6205460 0.000000e+00 3825
3 TraesCS2D01G271100 chr5D 96.687 2083 35 7 248 2327 449151290 449153341 0.000000e+00 3434
4 TraesCS2D01G271100 chr1D 97.082 2330 37 4 1 2327 483916491 483918792 0.000000e+00 3897
5 TraesCS2D01G271100 chr1D 97.080 2329 33 7 1 2327 254496119 254493824 0.000000e+00 3892
6 TraesCS2D01G271100 chr1D 89.726 292 3 1 2036 2327 483920116 483919852 4.760000e-92 348
7 TraesCS2D01G271100 chr3B 96.652 2330 45 6 1 2327 201511239 201508940 0.000000e+00 3840
8 TraesCS2D01G271100 chr3D 96.950 2164 36 3 166 2327 21902036 21899901 0.000000e+00 3603
9 TraesCS2D01G271100 chr4D 94.678 2330 78 12 1 2327 19914609 19912323 0.000000e+00 3574
10 TraesCS2D01G271100 chr2B 97.676 1291 27 2 533 1820 474898529 474899819 0.000000e+00 2215
11 TraesCS2D01G271100 chr2B 97.909 1052 16 4 1 1049 474897488 474898536 0.000000e+00 1816
12 TraesCS2D01G271100 chr2B 96.842 95 3 0 2044 2138 171456124 171456030 2.390000e-35 159
13 TraesCS2D01G271100 chr7D 93.870 571 8 1 1757 2327 231612970 231613513 0.000000e+00 835
14 TraesCS2D01G271100 chr2A 91.511 589 15 9 1739 2327 42773056 42773609 0.000000e+00 778
15 TraesCS2D01G271100 chrUn 91.733 375 4 1 1953 2327 317470476 317470823 1.610000e-136 496
16 TraesCS2D01G271100 chrUn 90.774 336 4 1 1992 2327 412877954 412877646 7.690000e-115 424


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G271100 chr2D 334228279 334230605 2326 True 4298.0 4298 100.0000 1 2327 1 chr2D.!!$R1 2326
1 TraesCS2D01G271100 chr5D 240133516 240135817 2301 True 3908.0 3908 97.1670 1 2327 1 chr5D.!!$R1 2326
2 TraesCS2D01G271100 chr5D 6203165 6205460 2295 False 3825.0 3825 96.5650 1 2327 1 chr5D.!!$F1 2326
3 TraesCS2D01G271100 chr5D 449151290 449153341 2051 False 3434.0 3434 96.6870 248 2327 1 chr5D.!!$F2 2079
4 TraesCS2D01G271100 chr1D 483916491 483918792 2301 False 3897.0 3897 97.0820 1 2327 1 chr1D.!!$F1 2326
5 TraesCS2D01G271100 chr1D 254493824 254496119 2295 True 3892.0 3892 97.0800 1 2327 1 chr1D.!!$R1 2326
6 TraesCS2D01G271100 chr3B 201508940 201511239 2299 True 3840.0 3840 96.6520 1 2327 1 chr3B.!!$R1 2326
7 TraesCS2D01G271100 chr3D 21899901 21902036 2135 True 3603.0 3603 96.9500 166 2327 1 chr3D.!!$R1 2161
8 TraesCS2D01G271100 chr4D 19912323 19914609 2286 True 3574.0 3574 94.6780 1 2327 1 chr4D.!!$R1 2326
9 TraesCS2D01G271100 chr2B 474897488 474899819 2331 False 2015.5 2215 97.7925 1 1820 2 chr2B.!!$F1 1819
10 TraesCS2D01G271100 chr7D 231612970 231613513 543 False 835.0 835 93.8700 1757 2327 1 chr7D.!!$F1 570
11 TraesCS2D01G271100 chr2A 42773056 42773609 553 False 778.0 778 91.5110 1739 2327 1 chr2A.!!$F1 588

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
853 858 5.617252 AGAAATAACTGAACGGAGTGGAAA 58.383 37.5 0.0 0.0 45.0 3.13 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1936 2455 3.892588 AGCAACCCTTTCGTAAATCCAAA 59.107 39.13 0.0 0.0 0.0 3.28 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
457 458 6.371595 TCCTTTGGTGCAAATCCAATTATT 57.628 33.333 7.99 0.0 43.25 1.40
575 576 9.729281 TCCTTTATGTTAAAAGAACGGACTAAT 57.271 29.630 0.00 0.0 38.50 1.73
702 703 8.322906 CAAAGAATGTGGACTATACAAGTTCA 57.677 34.615 0.00 0.0 41.76 3.18
853 858 5.617252 AGAAATAACTGAACGGAGTGGAAA 58.383 37.500 0.00 0.0 45.00 3.13
1052 1571 2.032377 GGAGACGACGAACAAAAATGCA 60.032 45.455 0.00 0.0 0.00 3.96
1606 2125 7.712797 AGTTTCGATTGGAATTGTACTTTTGT 58.287 30.769 0.00 0.0 33.85 2.83
1696 2215 7.274250 GCTTGAAATTGCTTTTCGTTCTCATAT 59.726 33.333 7.78 0.0 45.63 1.78
1936 2455 7.201487 GGTTGCTTGAATTTACGAAAAGTTTGT 60.201 33.333 0.00 0.0 0.00 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
411 412 9.897040 AGGAAACCATAAATTCCATATACCATT 57.103 29.630 7.25 0.0 46.14 3.16
557 558 7.099120 TGACCCTATTAGTCCGTTCTTTTAAC 58.901 38.462 0.00 0.0 33.09 2.01
702 703 7.670364 CCCTTTCTTTCATCAAAAGGTATTGT 58.330 34.615 11.10 0.0 44.94 2.71
853 858 5.843969 AGTAACCTTCCCAACCATGATTTTT 59.156 36.000 0.00 0.0 0.00 1.94
1052 1571 6.071165 CCCTCTAAAGTTTGAGGCAAATGAAT 60.071 38.462 20.21 0.0 45.15 2.57
1643 2162 9.357652 CCAGTCAATTTCAATAATTACAGGTTG 57.642 33.333 0.00 0.0 0.00 3.77
1707 2226 9.614792 AACAGGCTCGTATTTTATCTTTCTTAT 57.385 29.630 0.00 0.0 0.00 1.73
1936 2455 3.892588 AGCAACCCTTTCGTAAATCCAAA 59.107 39.130 0.00 0.0 0.00 3.28
2281 2808 8.669243 CAAACAACAGAAAGAGTAAGAACTTCT 58.331 33.333 0.00 0.0 35.56 2.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.