Multiple sequence alignment - TraesCS2D01G271000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G271000 chr2D 100.000 2201 0 0 1 2201 334227074 334229274 0.000000e+00 4065
1 TraesCS2D01G271000 chr5D 96.143 2204 49 8 1 2201 6206665 6204495 0.000000e+00 3567
2 TraesCS2D01G271000 chr5D 96.543 2054 37 7 152 2201 240132461 240134484 0.000000e+00 3369
3 TraesCS2D01G271000 chr5D 96.292 1591 28 4 611 2201 449153933 449152374 0.000000e+00 2582
4 TraesCS2D01G271000 chr3B 96.051 2203 54 6 1 2201 201507736 201509907 0.000000e+00 3555
5 TraesCS2D01G271000 chr3D 95.869 2203 42 6 1 2201 21898714 21900869 0.000000e+00 3518
6 TraesCS2D01G271000 chr4D 94.190 2203 64 13 1 2201 19911138 19913278 0.000000e+00 3301
7 TraesCS2D01G271000 chr1D 96.164 1825 36 5 123 1944 254490942 254492735 0.000000e+00 2952
8 TraesCS2D01G271000 chr1D 96.169 1723 31 7 1 1719 483921800 483920109 0.000000e+00 2784
9 TraesCS2D01G271000 chr1D 96.383 1410 24 1 792 2201 483919206 483917824 0.000000e+00 2296
10 TraesCS2D01G271000 chr1D 97.831 1291 24 3 1 1288 394180075 394181364 0.000000e+00 2226
11 TraesCS2D01G271000 chr1D 96.167 1148 16 2 1054 2201 254493672 254494791 0.000000e+00 1851
12 TraesCS2D01G271000 chr1D 95.311 981 19 1 1220 2200 254493682 254492729 0.000000e+00 1531
13 TraesCS2D01G271000 chrUn 96.149 1584 26 7 1 1580 317472028 317470476 0.000000e+00 2555
14 TraesCS2D01G271000 chr6D 97.436 1209 25 4 1 1206 431404065 431405270 0.000000e+00 2056
15 TraesCS2D01G271000 chr2A 93.196 823 20 10 972 1794 42773842 42773056 0.000000e+00 1177
16 TraesCS2D01G271000 chr7D 94.017 585 8 1 1192 1776 231613527 231612970 0.000000e+00 861
17 TraesCS2D01G271000 chr6B 96.571 175 6 0 1 175 276897523 276897349 7.690000e-75 291
18 TraesCS2D01G271000 chr7B 97.576 165 3 1 1 165 262233605 262233442 4.630000e-72 281
19 TraesCS2D01G271000 chr1A 87.552 241 3 1 1267 1507 4011716 4011929 1.010000e-63 254


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G271000 chr2D 334227074 334229274 2200 False 4065.0 4065 100.0000 1 2201 1 chr2D.!!$F1 2200
1 TraesCS2D01G271000 chr5D 6204495 6206665 2170 True 3567.0 3567 96.1430 1 2201 1 chr5D.!!$R1 2200
2 TraesCS2D01G271000 chr5D 240132461 240134484 2023 False 3369.0 3369 96.5430 152 2201 1 chr5D.!!$F1 2049
3 TraesCS2D01G271000 chr5D 449152374 449153933 1559 True 2582.0 2582 96.2920 611 2201 1 chr5D.!!$R2 1590
4 TraesCS2D01G271000 chr3B 201507736 201509907 2171 False 3555.0 3555 96.0510 1 2201 1 chr3B.!!$F1 2200
5 TraesCS2D01G271000 chr3D 21898714 21900869 2155 False 3518.0 3518 95.8690 1 2201 1 chr3D.!!$F1 2200
6 TraesCS2D01G271000 chr4D 19911138 19913278 2140 False 3301.0 3301 94.1900 1 2201 1 chr4D.!!$F1 2200
7 TraesCS2D01G271000 chr1D 483917824 483921800 3976 True 2540.0 2784 96.2760 1 2201 2 chr1D.!!$R2 2200
8 TraesCS2D01G271000 chr1D 254490942 254494791 3849 False 2401.5 2952 96.1655 123 2201 2 chr1D.!!$F2 2078
9 TraesCS2D01G271000 chr1D 394180075 394181364 1289 False 2226.0 2226 97.8310 1 1288 1 chr1D.!!$F1 1287
10 TraesCS2D01G271000 chr1D 254492729 254493682 953 True 1531.0 1531 95.3110 1220 2200 1 chr1D.!!$R1 980
11 TraesCS2D01G271000 chrUn 317470476 317472028 1552 True 2555.0 2555 96.1490 1 1580 1 chrUn.!!$R1 1579
12 TraesCS2D01G271000 chr6D 431404065 431405270 1205 False 2056.0 2056 97.4360 1 1206 1 chr6D.!!$F1 1205
13 TraesCS2D01G271000 chr2A 42773056 42773842 786 True 1177.0 1177 93.1960 972 1794 1 chr2A.!!$R1 822
14 TraesCS2D01G271000 chr7D 231612970 231613527 557 True 861.0 861 94.0170 1192 1776 1 chr7D.!!$R1 584

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
685 708 3.516586 TGGGTTGAACCTCAGAGTCATA 58.483 45.455 14.87 0.0 38.64 2.15 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1595 5221 7.201487 GGTTGCTTGAATTTACGAAAAGTTTGT 60.201 33.333 0.0 0.0 0.0 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
434 452 5.397360 ACAAGGAAGGAGGATTTTCAATGT 58.603 37.500 0.00 0.0 0.00 2.71
467 485 3.916035 ACATATCTCTCTGTAGCACCCA 58.084 45.455 0.00 0.0 0.00 4.51
595 616 4.811498 TGGGAGGGATAGATTTCTTCGTA 58.189 43.478 0.00 0.0 0.00 3.43
685 708 3.516586 TGGGTTGAACCTCAGAGTCATA 58.483 45.455 14.87 0.0 38.64 2.15
690 713 6.434340 GGGTTGAACCTCAGAGTCATAAAAAT 59.566 38.462 14.87 0.0 38.64 1.82
761 784 4.446889 CCCAAGCTAAATAAGGCCTCAGAT 60.447 45.833 5.23 0.0 0.00 2.90
1250 4876 8.669243 CAAACAACAGAAAGAGTAAGAACTTCT 58.331 33.333 0.00 0.0 35.56 2.85
1595 5221 3.892588 AGCAACCCTTTCGTAAATCCAAA 59.107 39.130 0.00 0.0 0.00 3.28
1824 5450 9.614792 AACAGGCTCGTATTTTATCTTTCTTAT 57.385 29.630 0.00 0.0 0.00 1.73
1888 5514 9.357652 CCAGTCAATTTCAATAATTACAGGTTG 57.642 33.333 0.00 0.0 0.00 3.77
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
3 4 6.219417 ACAAAATGTCACAGGTTCAAATCA 57.781 33.333 0.00 0.00 0.00 2.57
97 98 7.004086 TGGAAAAGAAGACAGGAATTGTGTAT 58.996 34.615 0.00 0.00 41.05 2.29
257 275 9.292751 AGGAAAAGTAATCCTTCCTTTATAGGA 57.707 33.333 0.00 0.00 45.37 2.94
293 311 5.443230 AAAAGATGACCCCTTCTTCCTAG 57.557 43.478 0.00 0.00 36.23 3.02
467 485 6.349300 CACCAAACCATAGAGTACTTAGCAT 58.651 40.000 0.00 0.00 0.00 3.79
646 669 6.554605 TCAACCCAATCCATCTTTTCTTTCTT 59.445 34.615 0.00 0.00 0.00 2.52
685 708 9.035890 TCAAAAATGGGGTTTACCAAAATTTTT 57.964 25.926 16.89 16.89 45.13 1.94
690 713 8.595362 ATTTTCAAAAATGGGGTTTACCAAAA 57.405 26.923 0.69 0.00 45.13 2.44
761 784 3.244215 CCCGCCTTTTCTATGCTCTGATA 60.244 47.826 0.00 0.00 0.00 2.15
821 844 5.415701 ACACAATCCTTGTCGAATTAGCAAT 59.584 36.000 0.00 0.00 43.23 3.56
1595 5221 7.201487 GGTTGCTTGAATTTACGAAAAGTTTGT 60.201 33.333 0.00 0.00 0.00 2.83
1835 5461 7.274250 GCTTGAAATTGCTTTTCGTTCTCATAT 59.726 33.333 7.78 0.00 45.63 1.78
1925 5551 7.712797 AGTTTCGATTGGAATTGTACTTTTGT 58.287 30.769 0.00 0.00 33.85 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.