Multiple sequence alignment - TraesCS2D01G270900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G270900 chr2D 100.000 2114 0 0 1 2114 334225621 334227734 0.000000e+00 3904
1 TraesCS2D01G270900 chr6D 97.362 2123 45 8 1 2114 431399726 431401846 0.000000e+00 3600
2 TraesCS2D01G270900 chr3B 97.222 2124 48 8 1 2114 201506275 201508397 0.000000e+00 3585
3 TraesCS2D01G270900 chr3B 97.159 176 5 0 1728 1903 386605052 386604877 4.410000e-77 298
4 TraesCS2D01G270900 chr3B 92.258 155 5 4 1892 2046 530853335 530853188 1.640000e-51 213
5 TraesCS2D01G270900 chr1D 97.093 2133 42 9 1 2114 394178606 394180737 0.000000e+00 3578
6 TraesCS2D01G270900 chr1D 94.442 2051 91 13 77 2114 244443826 244445866 0.000000e+00 3134
7 TraesCS2D01G270900 chr1D 97.392 1457 28 7 666 2114 483922592 483921138 0.000000e+00 2471
8 TraesCS2D01G270900 chrUn 97.042 2130 46 8 1 2114 317473494 317471366 0.000000e+00 3568
9 TraesCS2D01G270900 chrUn 97.155 1195 20 6 1 1181 404957930 404959124 0.000000e+00 2006
10 TraesCS2D01G270900 chrUn 97.895 760 11 3 46 801 53261896 53261138 0.000000e+00 1310
11 TraesCS2D01G270900 chr5D 96.983 2121 52 8 1 2114 6208118 6206003 0.000000e+00 3552
12 TraesCS2D01G270900 chr5D 97.249 1345 25 7 778 2114 554200522 554199182 0.000000e+00 2268
13 TraesCS2D01G270900 chr2A 96.425 2126 41 12 1 2111 335825975 335828080 0.000000e+00 3472
14 TraesCS2D01G270900 chr1A 98.467 783 7 3 1 778 256026471 256025689 0.000000e+00 1375
15 TraesCS2D01G270900 chr7D 95.745 846 31 4 1 843 88605285 88606128 0.000000e+00 1358
16 TraesCS2D01G270900 chr5A 97.953 684 10 2 1 680 684325284 684325967 0.000000e+00 1182
17 TraesCS2D01G270900 chr4A 96.093 691 20 7 1 688 677310057 677309371 0.000000e+00 1120
18 TraesCS2D01G270900 chr4A 92.797 236 9 1 1 236 710248725 710248952 3.360000e-88 335
19 TraesCS2D01G270900 chr4A 94.702 151 3 5 1967 2114 274759163 274759311 1.630000e-56 230
20 TraesCS2D01G270900 chr3A 96.000 200 4 3 1918 2114 59774091 59774289 2.620000e-84 322


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G270900 chr2D 334225621 334227734 2113 False 3904 3904 100.000 1 2114 1 chr2D.!!$F1 2113
1 TraesCS2D01G270900 chr6D 431399726 431401846 2120 False 3600 3600 97.362 1 2114 1 chr6D.!!$F1 2113
2 TraesCS2D01G270900 chr3B 201506275 201508397 2122 False 3585 3585 97.222 1 2114 1 chr3B.!!$F1 2113
3 TraesCS2D01G270900 chr1D 394178606 394180737 2131 False 3578 3578 97.093 1 2114 1 chr1D.!!$F2 2113
4 TraesCS2D01G270900 chr1D 244443826 244445866 2040 False 3134 3134 94.442 77 2114 1 chr1D.!!$F1 2037
5 TraesCS2D01G270900 chr1D 483921138 483922592 1454 True 2471 2471 97.392 666 2114 1 chr1D.!!$R1 1448
6 TraesCS2D01G270900 chrUn 317471366 317473494 2128 True 3568 3568 97.042 1 2114 1 chrUn.!!$R2 2113
7 TraesCS2D01G270900 chrUn 404957930 404959124 1194 False 2006 2006 97.155 1 1181 1 chrUn.!!$F1 1180
8 TraesCS2D01G270900 chrUn 53261138 53261896 758 True 1310 1310 97.895 46 801 1 chrUn.!!$R1 755
9 TraesCS2D01G270900 chr5D 6206003 6208118 2115 True 3552 3552 96.983 1 2114 1 chr5D.!!$R1 2113
10 TraesCS2D01G270900 chr5D 554199182 554200522 1340 True 2268 2268 97.249 778 2114 1 chr5D.!!$R2 1336
11 TraesCS2D01G270900 chr2A 335825975 335828080 2105 False 3472 3472 96.425 1 2111 1 chr2A.!!$F1 2110
12 TraesCS2D01G270900 chr1A 256025689 256026471 782 True 1375 1375 98.467 1 778 1 chr1A.!!$R1 777
13 TraesCS2D01G270900 chr7D 88605285 88606128 843 False 1358 1358 95.745 1 843 1 chr7D.!!$F1 842
14 TraesCS2D01G270900 chr5A 684325284 684325967 683 False 1182 1182 97.953 1 680 1 chr5A.!!$F1 679
15 TraesCS2D01G270900 chr4A 677309371 677310057 686 True 1120 1120 96.093 1 688 1 chr4A.!!$R1 687

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
96 97 2.325583 TTCTTGACCAAACTGCGAGT 57.674 45.000 0.0 0.0 0.0 4.18 F
902 929 7.592164 GGCATTCTACGACTCTTTAGACTAATC 59.408 40.741 0.0 0.0 0.0 1.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1064 1092 0.110419 TTGCAAATACGCAGTCACGC 60.110 50.000 0.0 0.0 44.14 5.34 R
1746 1780 5.443230 AAAAGATGACCCCTTCTTCCTAG 57.557 43.478 0.0 0.0 36.23 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
96 97 2.325583 TTCTTGACCAAACTGCGAGT 57.674 45.000 0.00 0.0 0.00 4.18
598 609 7.806690 TCTGATGAATCCACTTTCTTTTAACG 58.193 34.615 0.00 0.0 0.00 3.18
902 929 7.592164 GGCATTCTACGACTCTTTAGACTAATC 59.408 40.741 0.00 0.0 0.00 1.75
977 1005 9.597681 ATTTAGGGATAGATCGTACCTCTTTTA 57.402 33.333 8.07 0.0 32.87 1.52
1064 1092 9.449719 AATTCCTATTACTTTAGCGGGATTATG 57.550 33.333 0.00 0.0 0.00 1.90
1147 1181 5.843019 TTTTTATTGACCTCCTCCAGACT 57.157 39.130 0.00 0.0 0.00 3.24
1256 1290 5.957771 TGCTCTGTAGGATTTGAACCTAT 57.042 39.130 0.00 0.0 41.25 2.57
1456 1490 8.568617 AAAGAAGTAATAGGTAGGGATGACAT 57.431 34.615 0.00 0.0 0.00 3.06
1887 1922 5.397360 ACAAGGAAGGAGGATTTTCAATGT 58.603 37.500 0.00 0.0 0.00 2.71
1920 1955 3.916035 ACATATCTCTCTGTAGCACCCA 58.084 45.455 0.00 0.0 0.00 4.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
96 97 6.483307 CCTATTTCATCTCATAAAGTTCCGCA 59.517 38.462 0.00 0.0 0.00 5.69
869 893 3.452627 AGAGTCGTAGAATGCCAGGAATT 59.547 43.478 0.00 0.0 39.69 2.17
902 929 6.985117 TCAATGACCAAGAAAAGAATTCCTG 58.015 36.000 0.65 0.0 0.00 3.86
1009 1037 7.910683 GCCTAAGACGATTCCAAATAGAAAAAG 59.089 37.037 0.00 0.0 0.00 2.27
1064 1092 0.110419 TTGCAAATACGCAGTCACGC 60.110 50.000 0.00 0.0 44.14 5.34
1147 1181 6.886459 CCAATTTCAATTTGACCTCCTCTCTA 59.114 38.462 0.00 0.0 0.00 2.43
1206 1240 8.627208 ATTCCATCTATTTTATGTCGAAGCAT 57.373 30.769 0.00 0.0 0.00 3.79
1234 1268 5.425217 TCATAGGTTCAAATCCTACAGAGCA 59.575 40.000 0.00 0.0 39.88 4.26
1256 1290 1.271163 GGTCTCCAAAACCCGATGTCA 60.271 52.381 0.00 0.0 0.00 3.58
1456 1490 6.219417 ACAAAATGTCACAGGTTCAAATCA 57.781 33.333 0.00 0.0 0.00 2.57
1550 1584 7.004086 TGGAAAAGAAGACAGGAATTGTGTAT 58.996 34.615 0.00 0.0 41.05 2.29
1710 1744 9.292751 AGGAAAAGTAATCCTTCCTTTATAGGA 57.707 33.333 0.00 0.0 45.37 2.94
1746 1780 5.443230 AAAAGATGACCCCTTCTTCCTAG 57.557 43.478 0.00 0.0 36.23 3.02
1920 1955 6.349300 CACCAAACCATAGAGTACTTAGCAT 58.651 40.000 0.00 0.0 0.00 3.79


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.