Multiple sequence alignment - TraesCS2D01G270800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G270800 chr2D 100.000 2096 0 0 1 2096 334225349 334227444 0.000000e+00 3871
1 TraesCS2D01G270800 chr2D 97.037 270 8 0 1827 2096 141098401 141098132 2.450000e-124 455
2 TraesCS2D01G270800 chr3B 97.246 2106 48 7 1 2096 201506001 201508106 0.000000e+00 3559
3 TraesCS2D01G270800 chr6D 97.242 2103 44 7 1 2096 431399459 431401554 0.000000e+00 3550
4 TraesCS2D01G270800 chr1D 96.973 2114 40 9 1 2096 394178338 394180445 0.000000e+00 3528
5 TraesCS2D01G270800 chr1D 94.349 1752 81 10 349 2089 244443826 244445570 0.000000e+00 2671
6 TraesCS2D01G270800 chr1D 97.680 1164 21 4 938 2096 483922592 483921430 0.000000e+00 1995
7 TraesCS2D01G270800 chrUn 96.967 2110 44 7 1 2096 317473761 317471658 0.000000e+00 3524
8 TraesCS2D01G270800 chrUn 97.260 1387 23 7 82 1453 404957738 404959124 0.000000e+00 2337
9 TraesCS2D01G270800 chrUn 97.895 760 11 3 318 1073 53261896 53261138 0.000000e+00 1310
10 TraesCS2D01G270800 chr5D 97.072 2015 50 6 87 2096 6208305 6206295 0.000000e+00 3386
11 TraesCS2D01G270800 chr5D 97.297 1332 23 4 750 2068 554200515 554201846 0.000000e+00 2248
12 TraesCS2D01G270800 chr2A 95.829 2110 43 11 1 2096 335825714 335827792 0.000000e+00 3367
13 TraesCS2D01G270800 chr2A 97.262 986 23 3 3 984 276441648 276440663 0.000000e+00 1668
14 TraesCS2D01G270800 chr2A 96.471 255 8 1 204 458 490417821 490417568 8.940000e-114 420
15 TraesCS2D01G270800 chr2A 98.630 73 0 1 72 143 715783629 715783701 6.070000e-26 128
16 TraesCS2D01G270800 chr7D 95.459 1123 41 8 1 1115 88605008 88606128 0.000000e+00 1783
17 TraesCS2D01G270800 chr1A 96.970 1056 13 5 1 1050 256026731 256025689 0.000000e+00 1755
18 TraesCS2D01G270800 chr5A 96.343 957 17 4 1 952 684325024 684325967 0.000000e+00 1557
19 TraesCS2D01G270800 chr4D 94.737 76 3 1 6 80 348381098 348381023 1.310000e-22 117


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G270800 chr2D 334225349 334227444 2095 False 3871 3871 100.000 1 2096 1 chr2D.!!$F1 2095
1 TraesCS2D01G270800 chr3B 201506001 201508106 2105 False 3559 3559 97.246 1 2096 1 chr3B.!!$F1 2095
2 TraesCS2D01G270800 chr6D 431399459 431401554 2095 False 3550 3550 97.242 1 2096 1 chr6D.!!$F1 2095
3 TraesCS2D01G270800 chr1D 394178338 394180445 2107 False 3528 3528 96.973 1 2096 1 chr1D.!!$F2 2095
4 TraesCS2D01G270800 chr1D 244443826 244445570 1744 False 2671 2671 94.349 349 2089 1 chr1D.!!$F1 1740
5 TraesCS2D01G270800 chr1D 483921430 483922592 1162 True 1995 1995 97.680 938 2096 1 chr1D.!!$R1 1158
6 TraesCS2D01G270800 chrUn 317471658 317473761 2103 True 3524 3524 96.967 1 2096 1 chrUn.!!$R2 2095
7 TraesCS2D01G270800 chrUn 404957738 404959124 1386 False 2337 2337 97.260 82 1453 1 chrUn.!!$F1 1371
8 TraesCS2D01G270800 chrUn 53261138 53261896 758 True 1310 1310 97.895 318 1073 1 chrUn.!!$R1 755
9 TraesCS2D01G270800 chr5D 6206295 6208305 2010 True 3386 3386 97.072 87 2096 1 chr5D.!!$R1 2009
10 TraesCS2D01G270800 chr5D 554200515 554201846 1331 False 2248 2248 97.297 750 2068 1 chr5D.!!$F1 1318
11 TraesCS2D01G270800 chr2A 335825714 335827792 2078 False 3367 3367 95.829 1 2096 1 chr2A.!!$F1 2095
12 TraesCS2D01G270800 chr2A 276440663 276441648 985 True 1668 1668 97.262 3 984 1 chr2A.!!$R1 981
13 TraesCS2D01G270800 chr7D 88605008 88606128 1120 False 1783 1783 95.459 1 1115 1 chr7D.!!$F1 1114
14 TraesCS2D01G270800 chr1A 256025689 256026731 1042 True 1755 1755 96.970 1 1050 1 chr1A.!!$R1 1049
15 TraesCS2D01G270800 chr5A 684325024 684325967 943 False 1557 1557 96.343 1 952 1 chr5A.!!$F1 951

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
368 388 2.325583 TTCTTGACCAAACTGCGAGT 57.674 45.0 0.0 0.0 0.0 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1336 1395 0.110419 TTGCAAATACGCAGTCACGC 60.11 50.0 0.0 0.0 44.14 5.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
124 143 4.023291 TCAAGGCATCAATAGAAAACCCC 58.977 43.478 0.00 0.0 0.00 4.95
168 188 8.062065 ACTTTTCATTGGCTTCGGAATAATAA 57.938 30.769 0.00 0.0 0.00 1.40
197 217 4.776349 TCGGAATAGCAGCCAAAATCTTA 58.224 39.130 0.00 0.0 0.00 2.10
368 388 2.325583 TTCTTGACCAAACTGCGAGT 57.674 45.000 0.00 0.0 0.00 4.18
870 902 7.806690 TCTGATGAATCCACTTTCTTTTAACG 58.193 34.615 0.00 0.0 0.00 3.18
1174 1231 7.592164 GGCATTCTACGACTCTTTAGACTAATC 59.408 40.741 0.00 0.0 0.00 1.75
1249 1308 9.597681 ATTTAGGGATAGATCGTACCTCTTTTA 57.402 33.333 8.07 0.0 32.87 1.52
1336 1395 9.449719 AATTCCTATTACTTTAGCGGGATTATG 57.550 33.333 0.00 0.0 0.00 1.90
1419 1484 5.843019 TTTTTATTGACCTCCTCCAGACT 57.157 39.130 0.00 0.0 0.00 3.24
1528 1593 5.957771 TGCTCTGTAGGATTTGAACCTAT 57.042 39.130 0.00 0.0 41.25 2.57
1728 1793 8.568617 AAAGAAGTAATAGGTAGGGATGACAT 57.431 34.615 0.00 0.0 0.00 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
120 139 5.658198 AAGTAGAACCTACAAAAAGGGGT 57.342 39.130 6.86 0.0 41.32 4.95
168 188 4.150897 TGGCTGCTATTCCGAATTACTT 57.849 40.909 0.00 0.0 0.00 2.24
368 388 6.483307 CCTATTTCATCTCATAAAGTTCCGCA 59.517 38.462 0.00 0.0 0.00 5.69
1141 1195 3.452627 AGAGTCGTAGAATGCCAGGAATT 59.547 43.478 0.00 0.0 39.69 2.17
1174 1231 6.985117 TCAATGACCAAGAAAAGAATTCCTG 58.015 36.000 0.65 0.0 0.00 3.86
1281 1340 7.910683 GCCTAAGACGATTCCAAATAGAAAAAG 59.089 37.037 0.00 0.0 0.00 2.27
1336 1395 0.110419 TTGCAAATACGCAGTCACGC 60.110 50.000 0.00 0.0 44.14 5.34
1419 1484 6.886459 CCAATTTCAATTTGACCTCCTCTCTA 59.114 38.462 0.00 0.0 0.00 2.43
1478 1543 8.627208 ATTCCATCTATTTTATGTCGAAGCAT 57.373 30.769 0.00 0.0 0.00 3.79
1506 1571 5.425217 TCATAGGTTCAAATCCTACAGAGCA 59.575 40.000 0.00 0.0 39.88 4.26
1528 1593 1.271163 GGTCTCCAAAACCCGATGTCA 60.271 52.381 0.00 0.0 0.00 3.58
1728 1793 6.219417 ACAAAATGTCACAGGTTCAAATCA 57.781 33.333 0.00 0.0 0.00 2.57
1822 1887 7.004086 TGGAAAAGAAGACAGGAATTGTGTAT 58.996 34.615 0.00 0.0 41.05 2.29
1982 2064 9.292751 AGGAAAAGTAATCCTTCCTTTATAGGA 57.707 33.333 0.00 0.0 45.37 2.94
2018 2100 5.443230 AAAAGATGACCCCTTCTTCCTAG 57.557 43.478 0.00 0.0 36.23 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.