Multiple sequence alignment - TraesCS2D01G270700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G270700 chr2D 100.000 2252 0 0 1 2252 334226196 334223945 0.000 4159.0
1 TraesCS2D01G270700 chr2D 97.315 2235 34 9 1 2225 628285943 628283725 0.000 3771.0
2 TraesCS2D01G270700 chr6D 97.492 2233 39 9 1 2225 431400301 431398078 0.000 3797.0
3 TraesCS2D01G270700 chr6D 100.000 28 0 0 2225 2252 43788818 43788791 0.004 52.8
4 TraesCS2D01G270700 chr6D 100.000 28 0 0 2225 2252 132316896 132316923 0.004 52.8
5 TraesCS2D01G270700 chr6D 100.000 28 0 0 2225 2252 379018444 379018471 0.004 52.8
6 TraesCS2D01G270700 chr1D 97.271 2235 42 10 1 2225 254489976 254487751 0.000 3771.0
7 TraesCS2D01G270700 chr1D 97.349 1622 28 6 1 1614 394179187 394177573 0.000 2743.0
8 TraesCS2D01G270700 chr2A 97.134 2233 55 6 1 2225 276440800 276443031 0.000 3760.0
9 TraesCS2D01G270700 chr2A 96.374 2234 55 11 1 2225 335826554 335824338 0.000 3653.0
10 TraesCS2D01G270700 chr3D 96.998 2232 47 10 1 2225 21897830 21895612 0.000 3733.0
11 TraesCS2D01G270700 chr3B 96.652 2240 52 10 1 2225 201506852 201504621 0.000 3699.0
12 TraesCS2D01G270700 chr5D 96.607 2240 57 11 1 2225 329131431 329133666 0.000 3698.0
13 TraesCS2D01G270700 chr1A 97.494 2155 28 10 1 2147 256025892 256028028 0.000 3657.0
14 TraesCS2D01G270700 chr1A 100.000 28 0 0 2225 2252 344263087 344263114 0.004 52.8
15 TraesCS2D01G270700 chr1A 100.000 28 0 0 2225 2252 397356598 397356571 0.004 52.8
16 TraesCS2D01G270700 chr1A 100.000 28 0 0 2225 2252 545353397 545353424 0.004 52.8
17 TraesCS2D01G270700 chrUn 96.569 991 20 5 1 984 317472913 317473896 0.000 1629.0
18 TraesCS2D01G270700 chr7D 95.398 891 32 7 1 884 88605861 88604973 0.000 1410.0
19 TraesCS2D01G270700 chr3A 100.000 29 0 0 2224 2252 370820779 370820751 0.001 54.7
20 TraesCS2D01G270700 chr1B 100.000 29 0 0 2224 2252 154978088 154978060 0.001 54.7
21 TraesCS2D01G270700 chr7A 100.000 28 0 0 2225 2252 146931956 146931929 0.004 52.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G270700 chr2D 334223945 334226196 2251 True 4159 4159 100.000 1 2252 1 chr2D.!!$R1 2251
1 TraesCS2D01G270700 chr2D 628283725 628285943 2218 True 3771 3771 97.315 1 2225 1 chr2D.!!$R2 2224
2 TraesCS2D01G270700 chr6D 431398078 431400301 2223 True 3797 3797 97.492 1 2225 1 chr6D.!!$R2 2224
3 TraesCS2D01G270700 chr1D 254487751 254489976 2225 True 3771 3771 97.271 1 2225 1 chr1D.!!$R1 2224
4 TraesCS2D01G270700 chr1D 394177573 394179187 1614 True 2743 2743 97.349 1 1614 1 chr1D.!!$R2 1613
5 TraesCS2D01G270700 chr2A 276440800 276443031 2231 False 3760 3760 97.134 1 2225 1 chr2A.!!$F1 2224
6 TraesCS2D01G270700 chr2A 335824338 335826554 2216 True 3653 3653 96.374 1 2225 1 chr2A.!!$R1 2224
7 TraesCS2D01G270700 chr3D 21895612 21897830 2218 True 3733 3733 96.998 1 2225 1 chr3D.!!$R1 2224
8 TraesCS2D01G270700 chr3B 201504621 201506852 2231 True 3699 3699 96.652 1 2225 1 chr3B.!!$R1 2224
9 TraesCS2D01G270700 chr5D 329131431 329133666 2235 False 3698 3698 96.607 1 2225 1 chr5D.!!$F1 2224
10 TraesCS2D01G270700 chr1A 256025892 256028028 2136 False 3657 3657 97.494 1 2147 1 chr1A.!!$F1 2146
11 TraesCS2D01G270700 chrUn 317472913 317473896 983 False 1629 1629 96.569 1 984 1 chrUn.!!$F1 983
12 TraesCS2D01G270700 chr7D 88604973 88605861 888 True 1410 1410 95.398 1 884 1 chr7D.!!$R1 883

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
955 1008 2.761767 TGGTCGATCCCATCTTTTACGA 59.238 45.455 0.0 0.0 34.77 3.43 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1845 1907 0.037734 AAATTCCGCGGGTCCTTTCT 59.962 50.0 27.83 0.0 0.0 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
405 426 6.049955 TCCAACCAAAGTAGATTCGAAGAT 57.950 37.500 3.35 0.00 35.04 2.40
467 488 6.874278 TCTGTCTTTCCCTATTTCATCTCA 57.126 37.500 0.00 0.00 0.00 3.27
479 500 6.483307 CCTATTTCATCTCATAAAGTTCCGCA 59.517 38.462 0.00 0.00 0.00 5.69
679 700 4.150897 TGGCTGCTATTCCGAATTACTT 57.849 40.909 0.00 0.00 0.00 2.24
727 749 5.658198 AAGTAGAACCTACAAAAAGGGGT 57.342 39.130 6.86 0.00 41.32 4.95
955 1008 2.761767 TGGTCGATCCCATCTTTTACGA 59.238 45.455 0.00 0.00 34.77 3.43
997 1050 9.936759 TGAATGTATAAAATTTTTGGGAGTTCC 57.063 29.630 9.06 0.00 0.00 3.62
1281 1334 5.453903 CCTCAATGACCATAGATCGAACCTT 60.454 44.000 0.00 0.00 0.00 3.50
1535 1589 9.618890 TTCTTCAATTGAGAGAAAGAAAGAGAA 57.381 29.630 20.92 14.50 0.00 2.87
1633 1687 7.631161 GCATGACCAATTGATAAAATGTGGAGA 60.631 37.037 7.12 0.00 0.00 3.71
1845 1907 4.982241 CCCCCTTTATCTGATTAGAGCA 57.018 45.455 0.00 0.00 36.14 4.26
1895 1957 9.471084 TCTTATAACGCGAATTGAATCTATTCA 57.529 29.630 15.93 1.23 44.42 2.57
2153 2228 7.647907 ATTTGCTCACAATCACAAGAAATTC 57.352 32.000 0.00 0.00 35.21 2.17
2196 2273 2.557056 CTCTGTTTGTCCACTACCTCGA 59.443 50.000 0.00 0.00 0.00 4.04
2213 2290 4.753610 ACCTCGACTAAACCTAAGCAAAAC 59.246 41.667 0.00 0.00 0.00 2.43
2225 2302 5.420739 ACCTAAGCAAAACAAAAAGAGGTCA 59.579 36.000 0.00 0.00 28.54 4.02
2226 2303 6.098266 ACCTAAGCAAAACAAAAAGAGGTCAT 59.902 34.615 0.00 0.00 28.54 3.06
2227 2304 6.986231 CCTAAGCAAAACAAAAAGAGGTCATT 59.014 34.615 0.00 0.00 0.00 2.57
2228 2305 7.495606 CCTAAGCAAAACAAAAAGAGGTCATTT 59.504 33.333 0.00 0.00 0.00 2.32
2229 2306 7.686438 AAGCAAAACAAAAAGAGGTCATTTT 57.314 28.000 0.00 0.00 0.00 1.82
2230 2307 7.075674 AGCAAAACAAAAAGAGGTCATTTTG 57.924 32.000 15.42 15.42 44.97 2.44
2231 2308 6.878389 AGCAAAACAAAAAGAGGTCATTTTGA 59.122 30.769 21.22 0.00 43.28 2.69
2232 2309 7.064966 AGCAAAACAAAAAGAGGTCATTTTGAG 59.935 33.333 21.22 11.83 43.28 3.02
2233 2310 6.908870 AAACAAAAAGAGGTCATTTTGAGC 57.091 33.333 21.22 1.82 43.28 4.26
2240 2317 1.063031 GGTCATTTTGAGCGCTTTGC 58.937 50.000 13.26 0.00 46.98 3.68
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
405 426 9.793259 ACTTAAAAGGATAATTGAAGTGACTCA 57.207 29.630 0.00 0.0 0.00 3.41
479 500 2.325583 TTCTTGACCAAACTGCGAGT 57.674 45.000 0.00 0.0 0.00 4.18
650 671 4.776349 TCGGAATAGCAGCCAAAATCTTA 58.224 39.130 0.00 0.0 0.00 2.10
679 700 8.062065 ACTTTTCATTGGCTTCGGAATAATAA 57.938 30.769 0.00 0.0 0.00 1.40
723 745 4.023291 TCAAGGCATCAATAGAAAACCCC 58.977 43.478 0.00 0.0 0.00 4.95
867 920 9.892130 TCAATTTTGTACCAAAGGTGTATTTTT 57.108 25.926 0.00 0.0 36.19 1.94
979 1032 4.939052 TGCGGAACTCCCAAAAATTTTA 57.061 36.364 3.34 0.0 34.14 1.52
997 1050 2.743752 CCGTGCTTCCAGACATGCG 61.744 63.158 0.00 0.0 0.00 4.73
1281 1334 4.095782 GCCATCGCACTGTAAAAATAGGAA 59.904 41.667 0.00 0.0 34.03 3.36
1633 1687 1.356398 TCGGCCATTTCCCCTACTTTT 59.644 47.619 2.24 0.0 0.00 2.27
1845 1907 0.037734 AAATTCCGCGGGTCCTTTCT 59.962 50.000 27.83 0.0 0.00 2.52
1895 1957 7.750229 TCTTGTTGCTTCATAAGAGTGAATT 57.250 32.000 0.00 0.0 37.47 2.17
2196 2273 7.979537 CCTCTTTTTGTTTTGCTTAGGTTTAGT 59.020 33.333 0.00 0.0 0.00 2.24
2213 2290 3.426525 GCGCTCAAAATGACCTCTTTTTG 59.573 43.478 15.40 15.4 45.00 2.44


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.