Multiple sequence alignment - TraesCS2D01G269000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G269000 chr2D 100.000 3185 0 0 1 3185 330735978 330739162 0.000000e+00 5882
1 TraesCS2D01G269000 chr2B 97.096 3203 71 12 1 3185 399336907 399340105 0.000000e+00 5380
2 TraesCS2D01G269000 chr2A 98.223 2476 41 3 711 3185 437966005 437968478 0.000000e+00 4325
3 TraesCS2D01G269000 chr2A 96.303 541 11 7 1 535 437964873 437965410 0.000000e+00 880
4 TraesCS2D01G269000 chr2A 97.619 126 3 0 533 658 437965494 437965619 1.920000e-52 217


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G269000 chr2D 330735978 330739162 3184 False 5882.000000 5882 100.000000 1 3185 1 chr2D.!!$F1 3184
1 TraesCS2D01G269000 chr2B 399336907 399340105 3198 False 5380.000000 5380 97.096000 1 3185 1 chr2B.!!$F1 3184
2 TraesCS2D01G269000 chr2A 437964873 437968478 3605 False 1807.333333 4325 97.381667 1 3185 3 chr2A.!!$F1 3184

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
686 788 0.871722 TTTATCGCTGGTGTGTGTGC 59.128 50.000 0.00 0.00 0.00 4.57 F
1427 1868 2.163815 AGCACTCATTGAGCAGAAATGC 59.836 45.455 13.64 13.74 35.43 3.56 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1680 2121 0.112995 TCCCAATTGGAGCTTGCACT 59.887 50.00 26.60 0.00 38.61 4.40 R
2982 3424 3.450457 TGTTCTTGACAAATGGCCAGTTT 59.550 39.13 17.35 11.24 34.69 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 41 3.306989 CCTGTGATGTGGCTTCTGACTTA 60.307 47.826 0.00 0.00 0.00 2.24
41 42 3.930336 TGTGATGTGGCTTCTGACTTAG 58.070 45.455 0.00 0.00 0.00 2.18
81 84 1.519408 TAAGGTCTTCAGCGCAAACC 58.481 50.000 11.47 9.37 0.00 3.27
138 141 1.087501 GTGTTGGAATCGAAGGAGCC 58.912 55.000 0.00 0.00 0.00 4.70
469 482 2.486592 CAGTGTTGAGCTCATGATGCAA 59.513 45.455 19.04 0.00 0.00 4.08
553 654 8.902540 TCACTACATACTTTGTCTGTTTCAAT 57.097 30.769 0.00 0.00 39.87 2.57
593 694 7.921786 TGTTTTACCTGAATCCAGAATGTAG 57.078 36.000 0.00 0.00 43.02 2.74
686 788 0.871722 TTTATCGCTGGTGTGTGTGC 59.128 50.000 0.00 0.00 0.00 4.57
1296 1737 4.385405 GCCTCTGCAGCGAGTGGT 62.385 66.667 9.47 0.00 37.47 4.16
1407 1848 3.004002 TGAGCAAGCATGTCAAAGACAAG 59.996 43.478 3.74 0.97 45.96 3.16
1424 1865 3.216800 ACAAGCACTCATTGAGCAGAAA 58.783 40.909 13.64 0.00 34.66 2.52
1427 1868 2.163815 AGCACTCATTGAGCAGAAATGC 59.836 45.455 13.64 13.74 35.43 3.56
1680 2121 2.653726 ACACAACATGCTCAAGTTCCA 58.346 42.857 0.00 0.00 0.00 3.53
2079 2520 1.351350 GGCATTATACCTCCAGGGACC 59.649 57.143 0.00 0.00 40.27 4.46
2128 2569 2.233922 GCAGTGTCAGAGCTAAACCCTA 59.766 50.000 0.00 0.00 0.00 3.53
2145 2586 1.561542 CCTAGTCTGCTTGGGGTCAAT 59.438 52.381 0.00 0.00 34.61 2.57
2361 2802 8.761689 TGATAATGCTGTATCTAATATCCTGCA 58.238 33.333 8.19 0.00 32.58 4.41
2567 3008 9.296400 GTGCTTTTCACTTGTTACATTTTTAGA 57.704 29.630 0.00 0.00 42.38 2.10
2866 3308 7.834181 AGCCCTGCTTTTGTTAGATCTTTATTA 59.166 33.333 0.00 0.00 33.89 0.98
2982 3424 4.041075 TGGATGAAGTTGTAACCTGTGCTA 59.959 41.667 0.00 0.00 0.00 3.49
3103 3545 9.155975 ACTACATAAAACTTTGTATGAGCTCTG 57.844 33.333 16.19 1.74 32.94 3.35
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 41 9.014297 CCTTAAGTAATCAATTCAAACTCCACT 57.986 33.333 0.97 0.00 0.00 4.00
41 42 8.793592 ACCTTAAGTAATCAATTCAAACTCCAC 58.206 33.333 0.97 0.00 0.00 4.02
138 141 9.775854 AATATCTTCAAACCAGAGATATCACAG 57.224 33.333 5.32 0.00 32.84 3.66
469 482 7.823745 ATACAGGACAAGAGACATTTGTTTT 57.176 32.000 0.00 0.00 38.78 2.43
553 654 8.410141 CAGGTAAAACATCACCAAGAAAACTTA 58.590 33.333 0.00 0.00 37.28 2.24
660 762 2.673368 CACACCAGCGATAAACTCCTTC 59.327 50.000 0.00 0.00 0.00 3.46
1407 1848 2.527100 GCATTTCTGCTCAATGAGTGC 58.473 47.619 12.29 8.65 45.32 4.40
1427 1868 2.525750 ATGCTGCGTTAATGTGTTCG 57.474 45.000 0.00 0.00 0.00 3.95
1680 2121 0.112995 TCCCAATTGGAGCTTGCACT 59.887 50.000 26.60 0.00 38.61 4.40
2079 2520 5.624344 AGTCTTGCATTGAGATTGACTTG 57.376 39.130 0.00 0.00 30.33 3.16
2128 2569 0.610232 GCATTGACCCCAAGCAGACT 60.610 55.000 0.00 0.00 35.48 3.24
2145 2586 2.877097 TTTCAAGTAGCCCTGATGCA 57.123 45.000 0.00 0.00 0.00 3.96
2813 3255 6.177610 CAACCAAGACATAAGGGTAGCTAAA 58.822 40.000 0.00 0.00 32.21 1.85
2982 3424 3.450457 TGTTCTTGACAAATGGCCAGTTT 59.550 39.130 17.35 11.24 34.69 2.66
3075 3517 9.974750 GAGCTCATACAAAGTTTTATGTAGTTC 57.025 33.333 9.40 12.29 35.64 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.