Multiple sequence alignment - TraesCS2D01G253700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G253700 chr2D 100.000 2276 0 0 1 2276 306153154 306155429 0 4204
1 TraesCS2D01G253700 chr2D 97.884 1512 30 2 1 1511 637308435 637306925 0 2614
2 TraesCS2D01G253700 chrUn 98.743 1512 18 1 1 1511 257944382 257945893 0 2686
3 TraesCS2D01G253700 chrUn 98.280 1512 20 2 1 1511 233524998 233523492 0 2643
4 TraesCS2D01G253700 chr1D 98.413 1512 23 1 1 1511 212429139 212430650 0 2658
5 TraesCS2D01G253700 chr1D 98.566 767 11 0 1510 2276 212436258 212437024 0 1356
6 TraesCS2D01G253700 chr4D 98.214 1512 26 1 1 1511 123689232 123690743 0 2641
7 TraesCS2D01G253700 chr4D 98.044 767 15 0 1510 2276 123696384 123697150 0 1334
8 TraesCS2D01G253700 chr7B 98.148 1512 22 2 1 1511 698126663 698125157 0 2632
9 TraesCS2D01G253700 chr7A 98.016 1512 24 2 1 1511 60095928 60094422 0 2621
10 TraesCS2D01G253700 chr7A 97.817 1512 32 1 1 1511 211237864 211236353 0 2608
11 TraesCS2D01G253700 chr6B 97.884 1512 26 2 1 1511 128889713 128888207 0 2610
12 TraesCS2D01G253700 chr6B 98.044 767 15 0 1510 2276 388224312 388225078 0 1334
13 TraesCS2D01G253700 chr6B 98.044 767 14 1 1510 2276 388283203 388283968 0 1332
14 TraesCS2D01G253700 chr3D 98.305 767 13 0 1510 2276 281321113 281321879 0 1345
15 TraesCS2D01G253700 chr7D 98.044 767 15 0 1510 2276 578998169 578998935 0 1334
16 TraesCS2D01G253700 chr5A 97.914 767 16 0 1510 2276 238864344 238863578 0 1328
17 TraesCS2D01G253700 chr3A 97.784 767 17 0 1510 2276 725772989 725773755 0 1323
18 TraesCS2D01G253700 chr6A 97.781 766 17 0 1510 2275 155849671 155848906 0 1321


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G253700 chr2D 306153154 306155429 2275 False 4204 4204 100.000 1 2276 1 chr2D.!!$F1 2275
1 TraesCS2D01G253700 chr2D 637306925 637308435 1510 True 2614 2614 97.884 1 1511 1 chr2D.!!$R1 1510
2 TraesCS2D01G253700 chrUn 257944382 257945893 1511 False 2686 2686 98.743 1 1511 1 chrUn.!!$F1 1510
3 TraesCS2D01G253700 chrUn 233523492 233524998 1506 True 2643 2643 98.280 1 1511 1 chrUn.!!$R1 1510
4 TraesCS2D01G253700 chr1D 212429139 212430650 1511 False 2658 2658 98.413 1 1511 1 chr1D.!!$F1 1510
5 TraesCS2D01G253700 chr1D 212436258 212437024 766 False 1356 1356 98.566 1510 2276 1 chr1D.!!$F2 766
6 TraesCS2D01G253700 chr4D 123689232 123690743 1511 False 2641 2641 98.214 1 1511 1 chr4D.!!$F1 1510
7 TraesCS2D01G253700 chr4D 123696384 123697150 766 False 1334 1334 98.044 1510 2276 1 chr4D.!!$F2 766
8 TraesCS2D01G253700 chr7B 698125157 698126663 1506 True 2632 2632 98.148 1 1511 1 chr7B.!!$R1 1510
9 TraesCS2D01G253700 chr7A 60094422 60095928 1506 True 2621 2621 98.016 1 1511 1 chr7A.!!$R1 1510
10 TraesCS2D01G253700 chr7A 211236353 211237864 1511 True 2608 2608 97.817 1 1511 1 chr7A.!!$R2 1510
11 TraesCS2D01G253700 chr6B 128888207 128889713 1506 True 2610 2610 97.884 1 1511 1 chr6B.!!$R1 1510
12 TraesCS2D01G253700 chr6B 388224312 388225078 766 False 1334 1334 98.044 1510 2276 1 chr6B.!!$F1 766
13 TraesCS2D01G253700 chr6B 388283203 388283968 765 False 1332 1332 98.044 1510 2276 1 chr6B.!!$F2 766
14 TraesCS2D01G253700 chr3D 281321113 281321879 766 False 1345 1345 98.305 1510 2276 1 chr3D.!!$F1 766
15 TraesCS2D01G253700 chr7D 578998169 578998935 766 False 1334 1334 98.044 1510 2276 1 chr7D.!!$F1 766
16 TraesCS2D01G253700 chr5A 238863578 238864344 766 True 1328 1328 97.914 1510 2276 1 chr5A.!!$R1 766
17 TraesCS2D01G253700 chr3A 725772989 725773755 766 False 1323 1323 97.784 1510 2276 1 chr3A.!!$F1 766
18 TraesCS2D01G253700 chr6A 155848906 155849671 765 True 1321 1321 97.781 1510 2275 1 chr6A.!!$R1 765

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
141 142 2.306255 ATCGCCCTTACGCGGTCAAT 62.306 55.0 12.47 0.0 43.50 2.57 F
249 250 2.638480 TCCCTTGCTAAAGCGCATAT 57.362 45.0 11.47 0.0 45.83 1.78 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1257 1259 1.12053 GTTAGGGGAAGATCCGAGCA 58.879 55.0 0.0 0.0 37.43 4.26 R
2161 2163 0.87909 GCCTTTGGTTCTTGGTACGG 59.121 55.0 0.0 0.0 0.00 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
141 142 2.306255 ATCGCCCTTACGCGGTCAAT 62.306 55.000 12.47 0.00 43.50 2.57
222 223 4.319911 CCGAAAGAACAAGCAACGGATTTA 60.320 41.667 0.00 0.00 41.09 1.40
249 250 2.638480 TCCCTTGCTAAAGCGCATAT 57.362 45.000 11.47 0.00 45.83 1.78
256 257 4.027572 TGCTAAAGCGCATATGTTTTCC 57.972 40.909 11.47 0.00 45.83 3.13
733 734 4.819769 TGATGTGAATGATCGTGTCTTCA 58.180 39.130 0.00 0.00 0.00 3.02
844 845 6.942576 CCGATCCTAACATAATTTTGGAGGAT 59.057 38.462 22.99 22.99 42.09 3.24
883 884 7.498570 GCCTCAAAATCAGATAAAGATGTCTCT 59.501 37.037 0.00 0.00 0.00 3.10
1110 1112 7.878127 CGGTTCATAGTTGGGTATGATATTCTT 59.122 37.037 0.00 0.00 38.83 2.52
1257 1259 0.679640 TTGGATCCGCGAAGGCAATT 60.680 50.000 8.23 0.00 40.77 2.32
1787 1789 6.814506 ATCTTCACTTTTCACCTTCTCATG 57.185 37.500 0.00 0.00 0.00 3.07
1872 1874 6.886459 AGCACGGGCATAAATCAATAGAATAT 59.114 34.615 14.57 0.00 44.61 1.28
2161 2163 6.093633 ACCGATAAATGAGAAAAAGTACCAGC 59.906 38.462 0.00 0.00 0.00 4.85
2181 2183 1.600023 CGTACCAAGAACCAAAGGCA 58.400 50.000 0.00 0.00 0.00 4.75
2204 2206 8.834465 GGCACCAGCTTTCATTGATATATATAG 58.166 37.037 0.00 0.00 41.70 1.31
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
141 142 6.108687 CAGTCCTTGCATTAGTATGAGTTCA 58.891 40.000 0.00 0.00 33.37 3.18
222 223 0.253044 TTTAGCAAGGGATGAGCGCT 59.747 50.000 11.27 11.27 42.29 5.92
249 250 2.441750 AGTACCAAGGAGCAGGAAAACA 59.558 45.455 0.00 0.00 0.00 2.83
256 257 2.300152 TCAGACAAGTACCAAGGAGCAG 59.700 50.000 0.00 0.00 0.00 4.24
663 664 3.267483 AGCTACCGTTTAACGAATGCAT 58.733 40.909 19.61 0.00 46.05 3.96
844 845 3.437795 GAGGCTTCGTCGTCCGGA 61.438 66.667 0.00 0.00 37.11 5.14
883 884 4.047059 GGAAGTCCGGTCGCGTCA 62.047 66.667 5.77 0.00 0.00 4.35
1110 1112 1.600023 GACGTTCCCAACAATCCACA 58.400 50.000 0.00 0.00 0.00 4.17
1237 1239 1.376609 ATTGCCTTCGCGGATCCAAC 61.377 55.000 13.41 1.69 38.08 3.77
1257 1259 1.120530 GTTAGGGGAAGATCCGAGCA 58.879 55.000 0.00 0.00 37.43 4.26
1331 1333 3.708195 CTCAAAATGAGCCTTGCGG 57.292 52.632 0.00 0.00 37.72 5.69
1445 1447 2.769893 GTTTAGGCCGGTGAGTTACAA 58.230 47.619 1.90 0.00 0.00 2.41
1653 1655 6.015918 TGACCATCCCTTTTCAACACATATT 58.984 36.000 0.00 0.00 0.00 1.28
1787 1789 3.935828 GGAACAGATCACTGAGGTTAAGC 59.064 47.826 0.00 0.00 46.03 3.09
2161 2163 0.879090 GCCTTTGGTTCTTGGTACGG 59.121 55.000 0.00 0.00 0.00 4.02
2181 2183 8.260818 ACGCTATATATATCAATGAAAGCTGGT 58.739 33.333 0.00 0.00 0.00 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.