Multiple sequence alignment - TraesCS2D01G248300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G248300 chr2D 100.000 2798 0 0 1 2798 291994950 291992153 0.000000e+00 5168.0
1 TraesCS2D01G248300 chr2D 92.188 704 7 11 27 689 577604621 577605317 0.000000e+00 952.0
2 TraesCS2D01G248300 chr2B 96.201 2132 55 5 689 2798 368415799 368413672 0.000000e+00 3465.0
3 TraesCS2D01G248300 chr2A 96.184 1782 45 3 710 2469 342649925 342648145 0.000000e+00 2892.0
4 TraesCS2D01G248300 chr2A 97.425 233 6 0 2566 2798 342647895 342647663 5.620000e-107 398.0
5 TraesCS2D01G248300 chr7A 91.702 711 30 11 1 689 22640617 22641320 0.000000e+00 959.0
6 TraesCS2D01G248300 chr7A 83.333 78 11 1 2570 2647 163434403 163434328 1.390000e-08 71.3
7 TraesCS2D01G248300 chr6D 90.239 543 34 16 159 696 14160292 14159764 0.000000e+00 691.0
8 TraesCS2D01G248300 chr6D 93.126 451 22 3 2 452 14160528 14160087 0.000000e+00 652.0
9 TraesCS2D01G248300 chr1D 90.112 536 41 11 158 689 359480603 359480076 0.000000e+00 686.0
10 TraesCS2D01G248300 chr3B 90.631 523 34 12 167 683 162473414 162472901 0.000000e+00 680.0
11 TraesCS2D01G248300 chr3B 80.594 505 67 20 212 689 742166607 742166107 7.370000e-96 361.0
12 TraesCS2D01G248300 chr7B 90.359 529 32 15 167 689 459801771 459802286 0.000000e+00 676.0
13 TraesCS2D01G248300 chr6A 89.962 528 39 13 159 682 71112865 71113382 0.000000e+00 669.0
14 TraesCS2D01G248300 chr6A 100.000 31 0 0 2245 2275 99990337 99990307 1.080000e-04 58.4
15 TraesCS2D01G248300 chr6B 87.828 534 51 13 158 689 635267811 635267290 5.120000e-172 614.0
16 TraesCS2D01G248300 chr7D 72.697 304 67 13 2353 2651 242289580 242289288 1.380000e-13 87.9
17 TraesCS2D01G248300 chr3D 82.796 93 14 1 2555 2647 176132561 176132651 6.420000e-12 82.4
18 TraesCS2D01G248300 chr5A 84.615 78 10 1 2570 2647 275289613 275289538 2.990000e-10 76.8
19 TraesCS2D01G248300 chr1B 100.000 31 0 0 2245 2275 164949810 164949840 1.080000e-04 58.4
20 TraesCS2D01G248300 chr1B 100.000 31 0 0 2245 2275 487040978 487040948 1.080000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G248300 chr2D 291992153 291994950 2797 True 5168.0 5168 100.0000 1 2798 1 chr2D.!!$R1 2797
1 TraesCS2D01G248300 chr2D 577604621 577605317 696 False 952.0 952 92.1880 27 689 1 chr2D.!!$F1 662
2 TraesCS2D01G248300 chr2B 368413672 368415799 2127 True 3465.0 3465 96.2010 689 2798 1 chr2B.!!$R1 2109
3 TraesCS2D01G248300 chr2A 342647663 342649925 2262 True 1645.0 2892 96.8045 710 2798 2 chr2A.!!$R1 2088
4 TraesCS2D01G248300 chr7A 22640617 22641320 703 False 959.0 959 91.7020 1 689 1 chr7A.!!$F1 688
5 TraesCS2D01G248300 chr6D 14159764 14160528 764 True 671.5 691 91.6825 2 696 2 chr6D.!!$R1 694
6 TraesCS2D01G248300 chr1D 359480076 359480603 527 True 686.0 686 90.1120 158 689 1 chr1D.!!$R1 531
7 TraesCS2D01G248300 chr3B 162472901 162473414 513 True 680.0 680 90.6310 167 683 1 chr3B.!!$R1 516
8 TraesCS2D01G248300 chr3B 742166107 742166607 500 True 361.0 361 80.5940 212 689 1 chr3B.!!$R2 477
9 TraesCS2D01G248300 chr7B 459801771 459802286 515 False 676.0 676 90.3590 167 689 1 chr7B.!!$F1 522
10 TraesCS2D01G248300 chr6A 71112865 71113382 517 False 669.0 669 89.9620 159 682 1 chr6A.!!$F1 523
11 TraesCS2D01G248300 chr6B 635267290 635267811 521 True 614.0 614 87.8280 158 689 1 chr6B.!!$R1 531

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
22 23 0.321298 ACATCACTAACCACCACGCC 60.321 55.000 0.00 0.0 0.0 5.68 F
643 836 1.002430 CATGCTAGTGACACAGTGGGT 59.998 52.381 8.59 0.0 0.0 4.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1614 1813 1.028868 GTCCCCTCATGAACTGCTGC 61.029 60.0 0.0 0.0 0.0 5.25 R
2514 2733 0.749454 CCCCTTCCCAAATCTGCTCG 60.749 60.0 0.0 0.0 0.0 5.03 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 0.321298 ACATCACTAACCACCACGCC 60.321 55.000 0.00 0.00 0.00 5.68
238 243 9.237846 GAACTTTTTCTCAAATTCGATGAACTT 57.762 29.630 0.00 0.00 0.00 2.66
358 487 7.496529 TGAACTTTTTCTCAAACTCGATGAT 57.503 32.000 0.00 0.00 32.36 2.45
479 653 4.461781 AGAGTACATACAGTAGCAAACCGT 59.538 41.667 0.00 0.00 32.19 4.83
643 836 1.002430 CATGCTAGTGACACAGTGGGT 59.998 52.381 8.59 0.00 0.00 4.51
695 888 3.369366 CCAAGGAGGAGCTCTCTTTCTTC 60.369 52.174 14.64 0.00 39.41 2.87
797 994 3.095163 CTCTGCCCAGGCCCATCT 61.095 66.667 6.14 0.00 41.09 2.90
846 1043 1.191647 CGCGAACCGACTATTATTGCC 59.808 52.381 0.00 0.00 40.02 4.52
851 1048 3.906720 ACCGACTATTATTGCCACACT 57.093 42.857 0.00 0.00 0.00 3.55
862 1059 3.887621 TTGCCACACTGTCTATCCTAC 57.112 47.619 0.00 0.00 0.00 3.18
863 1060 2.108168 TGCCACACTGTCTATCCTACC 58.892 52.381 0.00 0.00 0.00 3.18
1233 1432 1.374252 GCTTCTTCGTGGCGAGGAA 60.374 57.895 13.70 13.70 46.46 3.36
1301 1500 4.335647 CAAGGCCTCCGCTGGTGT 62.336 66.667 5.23 0.00 34.44 4.16
1852 2051 8.680903 AGAATTCTTCGATTTGCATTCTAATGT 58.319 29.630 0.88 0.00 35.30 2.71
1948 2147 7.558161 TCTTGATCTGTAATATTTGCAGTGG 57.442 36.000 15.05 6.67 42.93 4.00
1965 2164 3.804325 CAGTGGTGTTTATAGCCTGATCG 59.196 47.826 0.00 0.00 0.00 3.69
1972 2171 7.011950 TGGTGTTTATAGCCTGATCGTATTTTG 59.988 37.037 0.00 0.00 0.00 2.44
1991 2190 5.923733 TTTGAAATTAGTGTTGTGGTGGT 57.076 34.783 0.00 0.00 0.00 4.16
2145 2364 3.719479 TCCTCAGATCTAGACACCTAGCT 59.281 47.826 0.00 0.00 41.65 3.32
2275 2494 5.749462 AGCAGCTACCAGTTAATGATTTCT 58.251 37.500 0.00 0.00 0.00 2.52
2278 2497 6.678900 GCAGCTACCAGTTAATGATTTCTTGG 60.679 42.308 0.00 0.00 0.00 3.61
2367 2586 6.423905 ACGGATCCAAAATAGATACATGTTCG 59.576 38.462 13.41 0.00 0.00 3.95
2514 2733 4.758688 CCAAGGGGTTTTCTGCAAATATC 58.241 43.478 0.00 0.00 0.00 1.63
2528 2747 3.565482 GCAAATATCGAGCAGATTTGGGA 59.435 43.478 18.63 0.00 39.75 4.37
2691 3063 8.999431 TGTATGTACAAAAGTTCTCTTCATTCC 58.001 33.333 0.00 0.00 32.40 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 2.095853 CGTAACCACATTAGGCTTGCTG 59.904 50.000 0.00 0.00 0.00 4.41
695 888 7.801783 GGTTGTGTCGTTTTTCTTATAGAAAGG 59.198 37.037 2.52 0.00 44.14 3.11
846 1043 2.040178 GGGGGTAGGATAGACAGTGTG 58.960 57.143 0.00 0.00 0.00 3.82
863 1060 4.468689 GAAGGGAGCGAACGGGGG 62.469 72.222 0.00 0.00 0.00 5.40
997 1196 1.378762 CCTTGGGGTTCGACATGGT 59.621 57.895 0.00 0.00 0.00 3.55
1215 1414 1.355066 CTTCCTCGCCACGAAGAAGC 61.355 60.000 13.52 0.00 43.87 3.86
1614 1813 1.028868 GTCCCCTCATGAACTGCTGC 61.029 60.000 0.00 0.00 0.00 5.25
1714 1913 1.381165 GGTGGTTGTCCAAACTGCGT 61.381 55.000 0.00 0.00 46.15 5.24
1852 2051 7.446769 TCACAACTAGCCAGAGTATTTAACAA 58.553 34.615 0.00 0.00 0.00 2.83
1926 2125 6.658816 ACACCACTGCAAATATTACAGATCAA 59.341 34.615 19.88 0.00 35.38 2.57
1948 2147 8.138365 TCAAAATACGATCAGGCTATAAACAC 57.862 34.615 0.00 0.00 0.00 3.32
1965 2164 7.923878 ACCACCACAACACTAATTTCAAAATAC 59.076 33.333 0.00 0.00 0.00 1.89
1972 2171 4.506288 GCAAACCACCACAACACTAATTTC 59.494 41.667 0.00 0.00 0.00 2.17
2026 2225 3.704566 ACGGGTCTCATCAGCTAAACATA 59.295 43.478 0.00 0.00 0.00 2.29
2367 2586 5.077134 AGGGTGATTATTTTCAAGCTTGC 57.923 39.130 21.99 5.57 0.00 4.01
2514 2733 0.749454 CCCCTTCCCAAATCTGCTCG 60.749 60.000 0.00 0.00 0.00 5.03
2691 3063 5.259632 AGAGGAGGAAATGGAACTGATTTG 58.740 41.667 0.00 0.00 0.00 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.