Multiple sequence alignment - TraesCS2D01G245800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G245800 chr2D 100.000 2445 0 0 1 2445 285065473 285063029 0.000000e+00 4516.0
1 TraesCS2D01G245800 chr2D 81.938 227 35 4 893 1114 37252159 37251934 1.150000e-43 187.0
2 TraesCS2D01G245800 chr2D 81.955 133 24 0 750 882 630003586 630003454 1.990000e-21 113.0
3 TraesCS2D01G245800 chr2D 75.983 229 36 11 1193 1402 37251917 37251689 1.550000e-17 100.0
4 TraesCS2D01G245800 chr3B 95.202 1730 74 3 719 2445 691503779 691502056 0.000000e+00 2726.0
5 TraesCS2D01G245800 chr3B 96.819 723 20 2 1 723 691504787 691504068 0.000000e+00 1205.0
6 TraesCS2D01G245800 chr6B 96.440 1573 50 5 719 2291 199961421 199962987 0.000000e+00 2590.0
7 TraesCS2D01G245800 chr6B 97.372 723 17 1 1 723 199960413 199961133 0.000000e+00 1229.0
8 TraesCS2D01G245800 chr6B 90.991 444 38 2 281 723 554790693 554790251 4.500000e-167 597.0
9 TraesCS2D01G245800 chr6B 96.491 57 2 0 2389 2445 199962978 199963034 7.200000e-16 95.3
10 TraesCS2D01G245800 chr1D 86.525 987 91 25 1482 2445 425969703 425970670 0.000000e+00 1048.0
11 TraesCS2D01G245800 chr6D 92.847 713 43 2 719 1431 171915955 171916659 0.000000e+00 1027.0
12 TraesCS2D01G245800 chr6D 88.692 734 56 12 1484 2216 171918960 171919667 0.000000e+00 870.0
13 TraesCS2D01G245800 chr6D 92.135 445 33 2 281 723 368754173 368753729 5.740000e-176 627.0
14 TraesCS2D01G245800 chr6D 83.333 144 22 2 737 879 462183901 462184043 5.490000e-27 132.0
15 TraesCS2D01G245800 chr5A 88.427 674 51 16 1791 2445 534072730 534072065 0.000000e+00 787.0
16 TraesCS2D01G245800 chr5A 85.093 322 36 9 1482 1800 534074477 534074165 3.920000e-83 318.0
17 TraesCS2D01G245800 chr6A 91.685 445 35 2 281 723 510251818 510251374 1.240000e-172 616.0
18 TraesCS2D01G245800 chr4A 89.802 353 35 1 371 723 220029597 220029948 3.710000e-123 451.0
19 TraesCS2D01G245800 chr5B 88.889 351 33 4 377 723 405791703 405791355 6.250000e-116 427.0
20 TraesCS2D01G245800 chr7B 87.977 341 37 4 385 723 388567294 388566956 1.360000e-107 399.0
21 TraesCS2D01G245800 chr3A 92.056 214 17 0 277 490 276472100 276471887 3.950000e-78 302.0
22 TraesCS2D01G245800 chr3A 89.840 187 14 3 1906 2091 276471830 276471648 4.060000e-58 235.0
23 TraesCS2D01G245800 chr3A 81.208 149 23 5 722 867 147811169 147811023 5.520000e-22 115.0
24 TraesCS2D01G245800 chr5D 79.778 361 50 15 1860 2216 417487938 417487597 8.740000e-60 241.0
25 TraesCS2D01G245800 chr7D 85.981 214 27 3 2210 2422 637732719 637732508 2.450000e-55 226.0
26 TraesCS2D01G245800 chr2A 82.379 227 29 9 893 1111 42153270 42153047 1.150000e-43 187.0
27 TraesCS2D01G245800 chr2B 85.034 147 21 1 893 1039 64988602 64988457 5.450000e-32 148.0
28 TraesCS2D01G245800 chr2B 81.333 150 21 7 722 867 789520937 789520791 5.520000e-22 115.0
29 TraesCS2D01G245800 chr2B 75.862 232 37 10 1193 1405 64988365 64988134 1.550000e-17 100.0
30 TraesCS2D01G245800 chr4D 82.432 148 25 1 720 867 471155372 471155518 7.100000e-26 128.0
31 TraesCS2D01G245800 chr3D 80.667 150 23 6 722 867 134170938 134170791 7.150000e-21 111.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G245800 chr2D 285063029 285065473 2444 True 4516.000000 4516 100.000000 1 2445 1 chr2D.!!$R1 2444
1 TraesCS2D01G245800 chr3B 691502056 691504787 2731 True 1965.500000 2726 96.010500 1 2445 2 chr3B.!!$R1 2444
2 TraesCS2D01G245800 chr6B 199960413 199963034 2621 False 1304.766667 2590 96.767667 1 2445 3 chr6B.!!$F1 2444
3 TraesCS2D01G245800 chr1D 425969703 425970670 967 False 1048.000000 1048 86.525000 1482 2445 1 chr1D.!!$F1 963
4 TraesCS2D01G245800 chr6D 171915955 171919667 3712 False 948.500000 1027 90.769500 719 2216 2 chr6D.!!$F2 1497
5 TraesCS2D01G245800 chr5A 534072065 534074477 2412 True 552.500000 787 86.760000 1482 2445 2 chr5A.!!$R1 963

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
879 1173 1.268625 GGTTTCCCACAATGGTCGAAC 59.731 52.381 0.0 0.0 35.17 3.95 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2146 6155 2.350895 CCATGGTTGCCTCCACGA 59.649 61.111 2.57 0.0 40.51 4.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 8.038944 ACATTTCTTCTTATGGCGTAGAAACTA 58.961 33.333 4.89 0.00 37.57 2.24
350 351 2.135933 GTACCAGGATGCGAGCAATAC 58.864 52.381 0.57 0.00 31.97 1.89
462 463 1.376543 CTCTCGCCATTGCATTCAGT 58.623 50.000 0.00 0.00 37.32 3.41
550 551 7.566760 TGTGACACATTTTACTGACTTCATT 57.433 32.000 3.56 0.00 0.00 2.57
680 681 2.721797 GCGAGAACAACAAGTATGTGCG 60.722 50.000 0.00 0.00 40.46 5.34
746 1040 3.553508 GCAGACCAAACAAGCATGACATT 60.554 43.478 0.00 0.00 0.00 2.71
837 1131 3.064324 GCAAAGCCGCCACCATCT 61.064 61.111 0.00 0.00 0.00 2.90
879 1173 1.268625 GGTTTCCCACAATGGTCGAAC 59.731 52.381 0.00 0.00 35.17 3.95
937 1231 5.357257 GGCCACGAGAACTTTATGAATCTA 58.643 41.667 0.00 0.00 0.00 1.98
996 1290 6.594159 CAGAGGTACGATGTTTGAATAAGGTT 59.406 38.462 0.00 0.00 0.00 3.50
1208 1502 4.855388 GCAGTTATGTTGCAGTCAAAGATG 59.145 41.667 0.00 0.00 41.17 2.90
1266 1560 2.628178 CGATGGGGATAGCTTACTGTCA 59.372 50.000 0.00 0.00 35.83 3.58
1302 1596 3.379452 AGTTGAATCTACCTGCTAGGCT 58.621 45.455 0.00 0.00 39.63 4.58
1514 4063 1.759445 AGCTGGTCTTGTCGCATCTAT 59.241 47.619 0.00 0.00 0.00 1.98
1516 4065 2.939103 GCTGGTCTTGTCGCATCTATTT 59.061 45.455 0.00 0.00 0.00 1.40
1614 4165 3.386726 GGTAAACCAGGGGGCATTTATTC 59.613 47.826 0.00 0.00 37.90 1.75
1789 4343 4.151121 TGGAAACAGATGAATGCTTGGAA 58.849 39.130 0.00 0.00 35.01 3.53
1820 5821 0.250901 AGCAAGCATCTTTGTCCGGT 60.251 50.000 0.00 0.00 0.00 5.28
1823 5824 1.879380 CAAGCATCTTTGTCCGGTTGA 59.121 47.619 0.00 0.00 38.75 3.18
2008 6010 9.632969 CCTCGTTCTATTAATGAAAATTACACG 57.367 33.333 0.00 0.34 0.00 4.49
2034 6040 0.611062 GGTTCCCCTACTGTTTGCCC 60.611 60.000 0.00 0.00 0.00 5.36
2035 6041 0.111639 GTTCCCCTACTGTTTGCCCA 59.888 55.000 0.00 0.00 0.00 5.36
2036 6042 1.080638 TTCCCCTACTGTTTGCCCAT 58.919 50.000 0.00 0.00 0.00 4.00
2037 6043 1.974028 TCCCCTACTGTTTGCCCATA 58.026 50.000 0.00 0.00 0.00 2.74
2038 6044 2.280103 TCCCCTACTGTTTGCCCATAA 58.720 47.619 0.00 0.00 0.00 1.90
2039 6045 2.856231 TCCCCTACTGTTTGCCCATAAT 59.144 45.455 0.00 0.00 0.00 1.28
2343 6384 8.522830 GGATGGTTATGAGTTGAGAATGAAAAA 58.477 33.333 0.00 0.00 0.00 1.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
77 78 9.167311 GATAATTCTTCCTTTGAGCTTCTACAA 57.833 33.333 0.00 0.00 0.00 2.41
169 170 8.119246 AGGCTCCAGTGATTATCTAGTGTATAT 58.881 37.037 0.00 0.00 0.00 0.86
170 171 7.394641 CAGGCTCCAGTGATTATCTAGTGTATA 59.605 40.741 0.00 0.00 0.00 1.47
293 294 1.985473 AAGAGTTGCTGCAACATCCA 58.015 45.000 37.75 6.82 45.66 3.41
516 517 9.897744 CAGTAAAATGTGTCACAATGTTATTCT 57.102 29.630 10.28 1.53 0.00 2.40
550 551 3.306641 GGTTTCATGCTGCCACCAAAATA 60.307 43.478 0.00 0.00 0.00 1.40
680 681 7.671495 AGCAACCATGTGAAATAATTTTTCC 57.329 32.000 9.26 4.18 0.00 3.13
837 1131 0.041238 AGGTCCGGTTCTCCAGATCA 59.959 55.000 0.00 0.00 0.00 2.92
873 1167 7.963981 TGAGATCAAATAAACATCTGTTCGAC 58.036 34.615 0.00 0.00 37.25 4.20
909 1203 1.053424 AAAGTTCTCGTGGCCCACTA 58.947 50.000 12.94 0.00 31.34 2.74
937 1231 4.098914 TGTTCTTCACCAATAGCCAAGT 57.901 40.909 0.00 0.00 0.00 3.16
1208 1502 2.093288 TCATCCAGTCCATGTTCTCAGC 60.093 50.000 0.00 0.00 0.00 4.26
1283 1577 4.345257 CCTTAGCCTAGCAGGTAGATTCAA 59.655 45.833 8.31 0.00 37.80 2.69
1302 1596 5.825593 AACTGTTGAGATGAGGTTCCTTA 57.174 39.130 0.00 0.00 0.00 2.69
1503 4052 7.371126 TGTATGTTTTCAAATAGATGCGACA 57.629 32.000 0.00 0.00 0.00 4.35
1576 4126 5.047164 TGGTTTACCATCGTTGCTCTAAGTA 60.047 40.000 0.00 0.00 42.01 2.24
1588 4138 1.453197 GCCCCCTGGTTTACCATCG 60.453 63.158 1.37 0.00 46.46 3.84
1614 4165 6.902341 TGCTGAGCAAATCTGTAACTAAAAG 58.098 36.000 3.81 0.00 34.76 2.27
1789 4343 6.364568 AAGATGCTTGCTTCCCTTAAAAAT 57.635 33.333 5.11 0.00 0.00 1.82
2146 6155 2.350895 CCATGGTTGCCTCCACGA 59.649 61.111 2.57 0.00 40.51 4.35
2371 6412 5.351465 GGAATATTGTCTTTCGCTTCACTCA 59.649 40.000 0.00 0.00 0.00 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.