Multiple sequence alignment - TraesCS2D01G244000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G244000 chr2D 100.000 2240 0 0 1 2240 272809754 272807515 0 4137
1 TraesCS2D01G244000 chr2A 98.797 2244 23 4 1 2240 726903963 726901720 0 3991
2 TraesCS2D01G244000 chr2A 96.836 2244 65 6 1 2240 335803580 335801339 0 3746
3 TraesCS2D01G244000 chr5D 98.396 2244 30 6 1 2240 503247764 503250005 0 3940
4 TraesCS2D01G244000 chr3D 98.351 2244 32 5 1 2240 589261035 589258793 0 3934
5 TraesCS2D01G244000 chr3B 98.307 2244 34 4 1 2240 201572295 201570052 0 3930
6 TraesCS2D01G244000 chr7B 98.306 2243 35 3 1 2240 662729406 662731648 0 3928
7 TraesCS2D01G244000 chr7B 98.083 2243 40 3 1 2240 663096933 663094691 0 3901
8 TraesCS2D01G244000 chr4A 98.036 2240 39 5 1 2237 583866414 583864177 0 3888
9 TraesCS2D01G244000 chr4A 95.365 2244 100 4 1 2240 310781583 310779340 0 3565


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G244000 chr2D 272807515 272809754 2239 True 4137 4137 100.000 1 2240 1 chr2D.!!$R1 2239
1 TraesCS2D01G244000 chr2A 726901720 726903963 2243 True 3991 3991 98.797 1 2240 1 chr2A.!!$R2 2239
2 TraesCS2D01G244000 chr2A 335801339 335803580 2241 True 3746 3746 96.836 1 2240 1 chr2A.!!$R1 2239
3 TraesCS2D01G244000 chr5D 503247764 503250005 2241 False 3940 3940 98.396 1 2240 1 chr5D.!!$F1 2239
4 TraesCS2D01G244000 chr3D 589258793 589261035 2242 True 3934 3934 98.351 1 2240 1 chr3D.!!$R1 2239
5 TraesCS2D01G244000 chr3B 201570052 201572295 2243 True 3930 3930 98.307 1 2240 1 chr3B.!!$R1 2239
6 TraesCS2D01G244000 chr7B 662729406 662731648 2242 False 3928 3928 98.306 1 2240 1 chr7B.!!$F1 2239
7 TraesCS2D01G244000 chr7B 663094691 663096933 2242 True 3901 3901 98.083 1 2240 1 chr7B.!!$R1 2239
8 TraesCS2D01G244000 chr4A 583864177 583866414 2237 True 3888 3888 98.036 1 2237 1 chr4A.!!$R2 2236
9 TraesCS2D01G244000 chr4A 310779340 310781583 2243 True 3565 3565 95.365 1 2240 1 chr4A.!!$R1 2239

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
486 487 1.144936 GCGCTGAAGTATGAGCCCT 59.855 57.895 0.0 0.0 30.98 5.19 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1548 1554 1.116536 TGAACCCAGCTCACGTACCA 61.117 55.0 0.0 0.0 0.0 3.25 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
486 487 1.144936 GCGCTGAAGTATGAGCCCT 59.855 57.895 0.00 0.0 30.98 5.19
621 622 1.259609 ATACCCGAAACCGACACAGA 58.740 50.000 0.00 0.0 0.00 3.41
993 995 2.766400 CGGAGAGAGGCTCGGTGAC 61.766 68.421 9.22 0.0 44.91 3.67
1075 1077 1.380380 CTGTTCCCTGGGATTGGCC 60.380 63.158 17.93 0.0 0.00 5.36
1275 1279 1.739667 GGAGGCGTGCAAAGGTTTT 59.260 52.632 0.00 0.0 0.00 2.43
1486 1492 4.994744 GGTTTGGCACCTCAATGC 57.005 55.556 0.00 0.0 43.29 3.56
1687 1693 3.069158 GGTGTACCAGTTATCGTGCCTAT 59.931 47.826 0.00 0.0 35.64 2.57
1916 1922 0.179018 AGGTGTCAAGTGGAAGTGCC 60.179 55.000 0.00 0.0 37.10 5.01
1947 1953 0.749649 AGCTGAGGCATCCTAACGAG 59.250 55.000 0.00 0.0 41.70 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
292 293 5.044919 AGGAATATTGACCTGTTGTCCATCA 60.045 40.000 0.00 0.00 43.78 3.07
317 318 2.767960 CCGTACCAACAAGGGGTAGTAT 59.232 50.000 0.00 0.00 41.37 2.12
602 603 1.259609 TCTGTGTCGGTTTCGGGTAT 58.740 50.000 0.00 0.00 36.95 2.73
621 622 5.016459 CCCTAGGTATTCTCTACCTACCCAT 59.984 48.000 8.29 0.00 45.47 4.00
993 995 4.208666 CGCATCTTCACAGACATGTCTATG 59.791 45.833 27.44 26.24 37.65 2.23
1075 1077 1.002624 TGCGTAGGAAAGGCCCAAG 60.003 57.895 0.00 0.00 38.23 3.61
1275 1279 0.395311 AATGTCCGTCTAGCCCGAGA 60.395 55.000 3.55 0.00 0.00 4.04
1548 1554 1.116536 TGAACCCAGCTCACGTACCA 61.117 55.000 0.00 0.00 0.00 3.25
1845 1851 8.651389 CCTTATCCTATTTCCATACTTCTGTCA 58.349 37.037 0.00 0.00 0.00 3.58
1916 1922 1.215244 CCTCAGCTGCATACATCACG 58.785 55.000 9.47 0.00 0.00 4.35
1947 1953 2.681152 ACAAGGTTCAAATCGTTCGC 57.319 45.000 0.00 0.00 0.00 4.70


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.