Multiple sequence alignment - TraesCS2D01G243900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G243900 chr2D 100.000 2201 0 0 1 2201 272806922 272809122 0 4065
1 TraesCS2D01G243900 chr2A 98.776 2205 23 4 1 2201 726901127 726903331 0 3919
2 TraesCS2D01G243900 chr2A 97.188 2205 56 6 1 2201 335800746 335802948 0 3723
3 TraesCS2D01G243900 chr2A 97.253 2148 53 5 1 2144 335822033 335824178 0 3635
4 TraesCS2D01G243900 chr7B 98.503 2204 30 3 1 2201 662732241 662730038 0 3884
5 TraesCS2D01G243900 chr7B 98.230 2204 36 3 1 2201 663094098 663096301 0 3851
6 TraesCS2D01G243900 chr3B 98.458 2205 30 4 1 2201 201569459 201571663 0 3880
7 TraesCS2D01G243900 chr3B 98.230 2204 34 5 1 2201 201544845 201542644 0 3849
8 TraesCS2D01G243900 chr3D 98.322 2205 32 5 1 2201 589258200 589260403 0 3862
9 TraesCS2D01G243900 chr4A 95.735 2204 87 6 1 2201 310757217 310755018 0 3542


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G243900 chr2D 272806922 272809122 2200 False 4065 4065 100.000 1 2201 1 chr2D.!!$F1 2200
1 TraesCS2D01G243900 chr2A 726901127 726903331 2204 False 3919 3919 98.776 1 2201 1 chr2A.!!$F3 2200
2 TraesCS2D01G243900 chr2A 335800746 335802948 2202 False 3723 3723 97.188 1 2201 1 chr2A.!!$F1 2200
3 TraesCS2D01G243900 chr2A 335822033 335824178 2145 False 3635 3635 97.253 1 2144 1 chr2A.!!$F2 2143
4 TraesCS2D01G243900 chr7B 662730038 662732241 2203 True 3884 3884 98.503 1 2201 1 chr7B.!!$R1 2200
5 TraesCS2D01G243900 chr7B 663094098 663096301 2203 False 3851 3851 98.230 1 2201 1 chr7B.!!$F1 2200
6 TraesCS2D01G243900 chr3B 201569459 201571663 2204 False 3880 3880 98.458 1 2201 1 chr3B.!!$F1 2200
7 TraesCS2D01G243900 chr3B 201542644 201544845 2201 True 3849 3849 98.230 1 2201 1 chr3B.!!$R1 2200
8 TraesCS2D01G243900 chr3D 589258200 589260403 2203 False 3862 3862 98.322 1 2201 1 chr3D.!!$F1 2200
9 TraesCS2D01G243900 chr4A 310755018 310757217 2199 True 3542 3542 95.735 1 2201 1 chr4A.!!$R1 2200

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
252 253 0.033503 GGGATTTGAACCCCCGACAT 60.034 55.0 0.0 0.0 41.38 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1757 1763 1.38038 CTGTTCCCTGGGATTGGCC 60.38 63.158 17.93 0.0 0.0 5.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
176 177 3.753272 CCGCTATCCCGATCATGATTTTT 59.247 43.478 10.14 0.00 0.00 1.94
252 253 0.033503 GGGATTTGAACCCCCGACAT 60.034 55.000 0.00 0.00 41.38 3.06
885 889 2.681152 ACAAGGTTCAAATCGTTCGC 57.319 45.000 0.00 0.00 0.00 4.70
916 920 1.215244 CCTCAGCTGCATACATCACG 58.785 55.000 9.47 0.00 0.00 4.35
1284 1288 1.116536 TGAACCCAGCTCACGTACCA 61.117 55.000 0.00 0.00 0.00 3.25
1420 1425 6.444171 AGCCTGTTATCCCTAGAGTAACTTTT 59.556 38.462 0.00 0.00 31.37 2.27
1557 1563 0.395311 AATGTCCGTCTAGCCCGAGA 60.395 55.000 3.55 0.00 0.00 4.04
1743 1749 1.296715 CCTTCCACCTAAGCTGCGT 59.703 57.895 0.00 0.00 0.00 5.24
1757 1763 1.002624 TGCGTAGGAAAGGCCCAAG 60.003 57.895 0.00 0.00 38.23 3.61
1839 1845 4.208666 CGCATCTTCACAGACATGTCTATG 59.791 45.833 27.44 26.24 37.65 2.23
1874 1880 1.607801 CCGAGACAGTGCCCAGATCA 61.608 60.000 0.00 0.00 0.00 2.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
524 525 4.498682 GCAAAATAGCTCGATGCCAGAATT 60.499 41.667 0.00 0.0 44.23 2.17
885 889 0.749649 AGCTGAGGCATCCTAACGAG 59.250 55.000 0.00 0.0 41.70 4.18
916 920 0.179018 AGGTGTCAAGTGGAAGTGCC 60.179 55.000 0.00 0.0 37.10 5.01
1145 1149 3.069158 GGTGTACCAGTTATCGTGCCTAT 59.931 47.826 0.00 0.0 35.64 2.57
1346 1350 4.994744 GGTTTGGCACCTCAATGC 57.005 55.556 0.00 0.0 43.29 3.56
1557 1563 1.739667 GGAGGCGTGCAAAGGTTTT 59.260 52.632 0.00 0.0 0.00 2.43
1757 1763 1.380380 CTGTTCCCTGGGATTGGCC 60.380 63.158 17.93 0.0 0.00 5.36
1839 1845 2.766400 CGGAGAGAGGCTCGGTGAC 61.766 68.421 9.22 0.0 44.91 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.