Multiple sequence alignment - TraesCS2D01G243700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G243700 chr2D 100.000 3182 0 0 1 3182 272805860 272802679 0 5877
1 TraesCS2D01G243700 chr2D 98.152 2760 49 2 424 3182 196967517 196964759 0 4813
2 TraesCS2D01G243700 chr2D 99.093 2206 19 1 978 3182 630266002 630268207 0 3962
3 TraesCS2D01G243700 chr2D 97.288 1217 11 4 1 1207 591992062 591993266 0 2045
4 TraesCS2D01G243700 chr7B 98.248 3197 39 5 1 3181 662733302 662736497 0 5578
5 TraesCS2D01G243700 chr7B 97.121 2952 67 4 248 3182 90404328 90401378 0 4964
6 TraesCS2D01G243700 chr3B 98.124 3198 43 5 1 3182 201564993 201561797 0 5557
7 TraesCS2D01G243700 chr3B 97.389 766 10 2 1 756 201545907 201546672 0 1295
8 TraesCS2D01G243700 chr3B 97.511 683 7 2 1 673 813250758 813251440 0 1158
9 TraesCS2D01G243700 chr3A 97.902 3194 53 6 1 3182 672882640 672879449 0 5515
10 TraesCS2D01G243700 chr1B 97.530 3199 60 6 1 3182 633733082 633729886 0 5452
11 TraesCS2D01G243700 chr5B 96.239 3191 94 16 1 3182 432872537 432875710 0 5204
12 TraesCS2D01G243700 chr7A 95.322 3121 122 16 76 3182 352681572 352678462 0 4933
13 TraesCS2D01G243700 chr1D 98.373 2643 30 5 1 2632 254531986 254534626 0 4630
14 TraesCS2D01G243700 chrUn 100.000 1222 0 0 1 1222 363864137 363862916 0 2257
15 TraesCS2D01G243700 chrUn 97.288 1217 12 5 1 1207 331843548 331842343 0 2045
16 TraesCS2D01G243700 chr5D 98.028 1217 13 3 1 1207 503258387 503257172 0 2104
17 TraesCS2D01G243700 chr6B 97.864 1217 14 3 1 1207 515380183 515378969 0 2093


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G243700 chr2D 272802679 272805860 3181 True 5877 5877 100.000 1 3182 1 chr2D.!!$R2 3181
1 TraesCS2D01G243700 chr2D 196964759 196967517 2758 True 4813 4813 98.152 424 3182 1 chr2D.!!$R1 2758
2 TraesCS2D01G243700 chr2D 630266002 630268207 2205 False 3962 3962 99.093 978 3182 1 chr2D.!!$F2 2204
3 TraesCS2D01G243700 chr2D 591992062 591993266 1204 False 2045 2045 97.288 1 1207 1 chr2D.!!$F1 1206
4 TraesCS2D01G243700 chr7B 662733302 662736497 3195 False 5578 5578 98.248 1 3181 1 chr7B.!!$F1 3180
5 TraesCS2D01G243700 chr7B 90401378 90404328 2950 True 4964 4964 97.121 248 3182 1 chr7B.!!$R1 2934
6 TraesCS2D01G243700 chr3B 201561797 201564993 3196 True 5557 5557 98.124 1 3182 1 chr3B.!!$R1 3181
7 TraesCS2D01G243700 chr3B 201545907 201546672 765 False 1295 1295 97.389 1 756 1 chr3B.!!$F1 755
8 TraesCS2D01G243700 chr3B 813250758 813251440 682 False 1158 1158 97.511 1 673 1 chr3B.!!$F2 672
9 TraesCS2D01G243700 chr3A 672879449 672882640 3191 True 5515 5515 97.902 1 3182 1 chr3A.!!$R1 3181
10 TraesCS2D01G243700 chr1B 633729886 633733082 3196 True 5452 5452 97.530 1 3182 1 chr1B.!!$R1 3181
11 TraesCS2D01G243700 chr5B 432872537 432875710 3173 False 5204 5204 96.239 1 3182 1 chr5B.!!$F1 3181
12 TraesCS2D01G243700 chr7A 352678462 352681572 3110 True 4933 4933 95.322 76 3182 1 chr7A.!!$R1 3106
13 TraesCS2D01G243700 chr1D 254531986 254534626 2640 False 4630 4630 98.373 1 2632 1 chr1D.!!$F1 2631
14 TraesCS2D01G243700 chrUn 363862916 363864137 1221 True 2257 2257 100.000 1 1222 1 chrUn.!!$R2 1221
15 TraesCS2D01G243700 chrUn 331842343 331843548 1205 True 2045 2045 97.288 1 1207 1 chrUn.!!$R1 1206
16 TraesCS2D01G243700 chr5D 503257172 503258387 1215 True 2104 2104 98.028 1 1207 1 chr5D.!!$R1 1206
17 TraesCS2D01G243700 chr6B 515378969 515380183 1214 True 2093 2093 97.864 1 1207 1 chr6B.!!$R1 1206

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1329 1361 7.174426 AGGGTAATTATGTTAGAATTAAGCCGC 59.826 37.037 0.0 0.0 32.11 6.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2268 2307 2.846827 AGGAGGGTCAAAATGGGTAGAG 59.153 50.0 0.0 0.0 0.0 2.43 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1329 1361 7.174426 AGGGTAATTATGTTAGAATTAAGCCGC 59.826 37.037 0.00 0.0 32.11 6.53
1901 1938 7.378728 CCGACGCTTTAAGAAAGAAAAGAATTT 59.621 33.333 3.15 0.0 41.02 1.82
2037 2076 9.362151 GGGATTTATCTAGTAGGAGATGATAGG 57.638 40.741 0.00 0.0 36.80 2.57
2085 2124 4.880696 CGTCCACCCGGGTTTATTAATTTA 59.119 41.667 27.83 0.0 38.11 1.40
3088 3141 7.725844 AGAAGAATCCACCAAAAGTTAGTGAAT 59.274 33.333 2.96 0.0 33.21 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1431 1465 3.440173 GCATACCTGTAGCAGCTTCAAAA 59.560 43.478 0.00 0.0 0.00 2.44
2037 2076 0.625849 TCCATCTCCAGGGGAAAAGC 59.374 55.000 0.00 0.0 0.00 3.51
2085 2124 8.691661 TTTTAACTAGCTGAGGAAGAATTTGT 57.308 30.769 0.00 0.0 0.00 2.83
2268 2307 2.846827 AGGAGGGTCAAAATGGGTAGAG 59.153 50.000 0.00 0.0 0.00 2.43
2482 2521 4.709397 ACTGATATGACTGCTATAGAGGGC 59.291 45.833 3.21 0.0 0.00 5.19
3088 3141 9.715121 CTTTATGTACTTTAGTGTTCCTAACCA 57.285 33.333 0.00 0.0 35.36 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.