Multiple sequence alignment - TraesCS2D01G243300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G243300 chr2D 100.000 2411 0 0 1 2411 272797813 272800223 0.000000e+00 4453.0
1 TraesCS2D01G243300 chrUn 98.924 2416 19 6 1 2411 93415924 93418337 0.000000e+00 4311.0
2 TraesCS2D01G243300 chr5D 98.841 2416 19 8 1 2411 560880890 560878479 0.000000e+00 4298.0
3 TraesCS2D01G243300 chr3B 97.888 2415 34 11 1 2411 201523088 201520687 0.000000e+00 4161.0
4 TraesCS2D01G243300 chr3B 97.163 141 2 1 2123 2263 804586607 804586469 1.110000e-58 237.0
5 TraesCS2D01G243300 chr3B 98.936 94 1 0 1889 1982 450530335 450530428 4.120000e-38 169.0
6 TraesCS2D01G243300 chr3A 97.428 2411 41 9 1 2411 672913928 672916317 0.000000e+00 4089.0
7 TraesCS2D01G243300 chr6A 97.345 2411 42 9 1 2411 271185851 271183463 0.000000e+00 4078.0
8 TraesCS2D01G243300 chr1A 96.143 2411 66 14 1 2411 168442219 168444602 0.000000e+00 3912.0
9 TraesCS2D01G243300 chr7B 96.236 2391 48 11 19 2407 559141373 559139023 0.000000e+00 3879.0
10 TraesCS2D01G243300 chr1D 98.838 1807 12 6 609 2411 144238516 144236715 0.000000e+00 3212.0
11 TraesCS2D01G243300 chr4A 98.051 1796 24 6 617 2411 722779092 722780877 0.000000e+00 3112.0
12 TraesCS2D01G243300 chr4A 83.333 690 78 15 1694 2379 593359368 593360024 9.540000e-169 603.0
13 TraesCS2D01G243300 chr4A 96.262 214 6 1 1961 2174 473647204 473646993 1.370000e-92 350.0
14 TraesCS2D01G243300 chr4A 97.917 48 0 1 2364 2411 319777709 319777755 5.520000e-12 82.4
15 TraesCS2D01G243300 chr2A 87.500 128 4 6 1794 1920 710270281 710270165 1.160000e-28 137.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G243300 chr2D 272797813 272800223 2410 False 4453 4453 100.000 1 2411 1 chr2D.!!$F1 2410
1 TraesCS2D01G243300 chrUn 93415924 93418337 2413 False 4311 4311 98.924 1 2411 1 chrUn.!!$F1 2410
2 TraesCS2D01G243300 chr5D 560878479 560880890 2411 True 4298 4298 98.841 1 2411 1 chr5D.!!$R1 2410
3 TraesCS2D01G243300 chr3B 201520687 201523088 2401 True 4161 4161 97.888 1 2411 1 chr3B.!!$R1 2410
4 TraesCS2D01G243300 chr3A 672913928 672916317 2389 False 4089 4089 97.428 1 2411 1 chr3A.!!$F1 2410
5 TraesCS2D01G243300 chr6A 271183463 271185851 2388 True 4078 4078 97.345 1 2411 1 chr6A.!!$R1 2410
6 TraesCS2D01G243300 chr1A 168442219 168444602 2383 False 3912 3912 96.143 1 2411 1 chr1A.!!$F1 2410
7 TraesCS2D01G243300 chr7B 559139023 559141373 2350 True 3879 3879 96.236 19 2407 1 chr7B.!!$R1 2388
8 TraesCS2D01G243300 chr1D 144236715 144238516 1801 True 3212 3212 98.838 609 2411 1 chr1D.!!$R1 1802
9 TraesCS2D01G243300 chr4A 722779092 722780877 1785 False 3112 3112 98.051 617 2411 1 chr4A.!!$F3 1794
10 TraesCS2D01G243300 chr4A 593359368 593360024 656 False 603 603 83.333 1694 2379 1 chr4A.!!$F2 685

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
650 652 1.410153 CATTGCCCCAAATGCCTCTAC 59.59 52.381 0.0 0.0 31.19 2.59 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2025 2046 3.826157 CCCCTGTCTTTGTTTATGCTTCA 59.174 43.478 0.0 0.0 0.0 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
94 95 4.776322 CCCGCTTGGATCACGGCA 62.776 66.667 9.45 0.00 45.58 5.69
570 572 5.241728 TGATGTGTATTCGAGTCATAGGAGG 59.758 44.000 0.00 0.00 0.00 4.30
650 652 1.410153 CATTGCCCCAAATGCCTCTAC 59.590 52.381 0.00 0.00 31.19 2.59
793 795 4.142249 CCAAAAGGAACTCGAGTTTTTGGT 60.142 41.667 37.15 23.16 42.59 3.67
1008 1017 7.293535 ACCTAGAATTAGAGTCTTATGGGCAAT 59.706 37.037 0.00 0.00 0.00 3.56
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
94 95 3.357203 TCGTCCTGCTTCTATCTGTCTT 58.643 45.455 0.0 0.0 0.00 3.01
445 446 9.384682 CAATTTGTTATTTCAATGCAAAAGGAC 57.615 29.630 0.0 0.0 32.58 3.85
793 795 0.392327 TCAATTCCTCGGCAATCGCA 60.392 50.000 0.0 0.0 41.24 5.10
1008 1017 7.620880 AGGTTAGTAAATCAGCAATAGTGTCA 58.379 34.615 0.0 0.0 0.00 3.58
2025 2046 3.826157 CCCCTGTCTTTGTTTATGCTTCA 59.174 43.478 0.0 0.0 0.00 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.