Multiple sequence alignment - TraesCS2D01G243200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G243200 chr2D 100.000 2372 0 0 1 2372 272797304 272799675 0.000000e+00 4381.0
1 TraesCS2D01G243200 chrUn 98.698 2381 22 8 1 2372 93415411 93417791 0.000000e+00 4217.0
2 TraesCS2D01G243200 chr5D 98.738 2378 20 9 3 2372 560881400 560879025 0.000000e+00 4217.0
3 TraesCS2D01G243200 chr5D 96.777 2141 41 10 1 2139 329123513 329125627 0.000000e+00 3546.0
4 TraesCS2D01G243200 chr3B 97.772 2379 37 11 1 2372 201523600 201521231 0.000000e+00 4085.0
5 TraesCS2D01G243200 chr3B 96.850 127 3 1 214 339 687455800 687455674 6.640000e-51 211.0
6 TraesCS2D01G243200 chr3B 92.727 55 3 1 89 142 386277169 386277115 7.030000e-11 78.7
7 TraesCS2D01G243200 chr3A 97.389 2375 42 9 1 2372 672913417 672915774 0.000000e+00 4024.0
8 TraesCS2D01G243200 chr4D 96.023 2389 61 14 1 2372 19925389 19923018 0.000000e+00 3855.0
9 TraesCS2D01G243200 chr7B 95.887 2334 47 14 52 2372 559141856 559139559 0.000000e+00 3733.0
10 TraesCS2D01G243200 chr2B 96.361 2226 62 10 1 2220 369624636 369622424 0.000000e+00 3644.0
11 TraesCS2D01G243200 chr1A 96.237 2046 54 12 327 2372 168442037 168444059 0.000000e+00 3330.0
12 TraesCS2D01G243200 chr2A 95.556 180 8 0 2118 2297 77267772 77267951 2.980000e-74 289.0
13 TraesCS2D01G243200 chr2A 88.298 188 11 6 266 446 82036225 82036408 5.130000e-52 215.0
14 TraesCS2D01G243200 chr2A 100.000 52 0 0 2246 2297 771309529 771309478 1.940000e-16 97.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G243200 chr2D 272797304 272799675 2371 False 4381 4381 100.000 1 2372 1 chr2D.!!$F1 2371
1 TraesCS2D01G243200 chrUn 93415411 93417791 2380 False 4217 4217 98.698 1 2372 1 chrUn.!!$F1 2371
2 TraesCS2D01G243200 chr5D 560879025 560881400 2375 True 4217 4217 98.738 3 2372 1 chr5D.!!$R1 2369
3 TraesCS2D01G243200 chr5D 329123513 329125627 2114 False 3546 3546 96.777 1 2139 1 chr5D.!!$F1 2138
4 TraesCS2D01G243200 chr3B 201521231 201523600 2369 True 4085 4085 97.772 1 2372 1 chr3B.!!$R1 2371
5 TraesCS2D01G243200 chr3A 672913417 672915774 2357 False 4024 4024 97.389 1 2372 1 chr3A.!!$F1 2371
6 TraesCS2D01G243200 chr4D 19923018 19925389 2371 True 3855 3855 96.023 1 2372 1 chr4D.!!$R1 2371
7 TraesCS2D01G243200 chr7B 559139559 559141856 2297 True 3733 3733 95.887 52 2372 1 chr7B.!!$R1 2320
8 TraesCS2D01G243200 chr2B 369622424 369624636 2212 True 3644 3644 96.361 1 2220 1 chr2B.!!$R1 2219
9 TraesCS2D01G243200 chr1A 168442037 168444059 2022 False 3330 3330 96.237 327 2372 1 chr1A.!!$F1 2045

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
603 620 4.776322 CCCGCTTGGATCACGGCA 62.776 66.667 9.45 0.0 45.58 5.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1517 1546 7.62088 AGGTTAGTAAATCAGCAATAGTGTCA 58.379 34.615 0.0 0.0 0.0 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
96 97 9.914131 AAATTAACAAATAAGACAGGAAAGAGC 57.086 29.630 0.00 0.00 0.00 4.09
603 620 4.776322 CCCGCTTGGATCACGGCA 62.776 66.667 9.45 0.00 45.58 5.69
1079 1106 5.241728 TGATGTGTATTCGAGTCATAGGAGG 59.758 44.000 0.00 0.00 0.00 4.30
1159 1186 1.410153 CATTGCCCCAAATGCCTCTAC 59.590 52.381 0.00 0.00 31.19 2.59
1302 1329 4.142249 CCAAAAGGAACTCGAGTTTTTGGT 60.142 41.667 37.15 23.16 42.59 3.67
1517 1546 7.293535 ACCTAGAATTAGAGTCTTATGGGCAAT 59.706 37.037 0.00 0.00 0.00 3.56
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
96 97 3.705604 AGAATTTGCGGGCGAATATTTG 58.294 40.909 6.56 0.0 30.42 2.32
603 620 3.357203 TCGTCCTGCTTCTATCTGTCTT 58.643 45.455 0.00 0.0 0.00 3.01
954 973 9.384682 CAATTTGTTATTTCAATGCAAAAGGAC 57.615 29.630 0.00 0.0 32.58 3.85
1302 1329 0.392327 TCAATTCCTCGGCAATCGCA 60.392 50.000 0.00 0.0 41.24 5.10
1517 1546 7.620880 AGGTTAGTAAATCAGCAATAGTGTCA 58.379 34.615 0.00 0.0 0.00 3.58


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.