Multiple sequence alignment - TraesCS2D01G243100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS2D01G243100 chr2D 100.000 2456 0 0 1 2456 272796731 272799186 0.000000e+00 4536
1 TraesCS2D01G243100 chrUn 98.580 2464 27 7 1 2456 93414837 93417300 0.000000e+00 4349
2 TraesCS2D01G243100 chr3B 97.643 2461 43 9 1 2456 201524172 201521722 0.000000e+00 4209
3 TraesCS2D01G243100 chr3A 97.439 2460 48 9 1 2456 672912845 672915293 0.000000e+00 4180
4 TraesCS2D01G243100 chr3A 96.460 339 11 1 2118 2456 471792984 471792647 2.130000e-155 558
5 TraesCS2D01G243100 chr3A 97.222 324 9 0 2133 2456 692573172 692572849 1.280000e-152 549
6 TraesCS2D01G243100 chr5D 97.279 2462 32 9 1 2456 503215382 503212950 0.000000e+00 4143
7 TraesCS2D01G243100 chr5D 98.742 2147 21 6 315 2456 560881661 560879516 0.000000e+00 3810
8 TraesCS2D01G243100 chr4D 96.831 2461 61 11 1 2456 19925959 19923511 0.000000e+00 4096
9 TraesCS2D01G243100 chr2B 96.896 2223 56 7 239 2456 369624971 369622757 0.000000e+00 3711
10 TraesCS2D01G243100 chr1D 97.862 2152 37 9 1 2146 254523232 254521084 0.000000e+00 3711
11 TraesCS2D01G243100 chr1A 97.530 2146 37 9 1 2142 584780607 584778474 0.000000e+00 3655
12 TraesCS2D01G243100 chr7A 98.559 555 4 1 1906 2456 201366794 201367348 0.000000e+00 977


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS2D01G243100 chr2D 272796731 272799186 2455 False 4536 4536 100.000 1 2456 1 chr2D.!!$F1 2455
1 TraesCS2D01G243100 chrUn 93414837 93417300 2463 False 4349 4349 98.580 1 2456 1 chrUn.!!$F1 2455
2 TraesCS2D01G243100 chr3B 201521722 201524172 2450 True 4209 4209 97.643 1 2456 1 chr3B.!!$R1 2455
3 TraesCS2D01G243100 chr3A 672912845 672915293 2448 False 4180 4180 97.439 1 2456 1 chr3A.!!$F1 2455
4 TraesCS2D01G243100 chr5D 503212950 503215382 2432 True 4143 4143 97.279 1 2456 1 chr5D.!!$R1 2455
5 TraesCS2D01G243100 chr5D 560879516 560881661 2145 True 3810 3810 98.742 315 2456 1 chr5D.!!$R2 2141
6 TraesCS2D01G243100 chr4D 19923511 19925959 2448 True 4096 4096 96.831 1 2456 1 chr4D.!!$R1 2455
7 TraesCS2D01G243100 chr2B 369622757 369624971 2214 True 3711 3711 96.896 239 2456 1 chr2B.!!$R1 2217
8 TraesCS2D01G243100 chr1D 254521084 254523232 2148 True 3711 3711 97.862 1 2146 1 chr1D.!!$R1 2145
9 TraesCS2D01G243100 chr1A 584778474 584780607 2133 True 3655 3655 97.530 1 2142 1 chr1A.!!$R1 2141
10 TraesCS2D01G243100 chr7A 201366794 201367348 554 False 977 977 98.559 1906 2456 1 chr7A.!!$F1 550

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
498 504 1.107114 TTTTTGGAAGCTCCGTTGCA 58.893 45.0 0.0 0.0 40.17 4.08 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1875 1906 0.392327 TCAATTCCTCGGCAATCGCA 60.392 50.0 0.0 0.0 41.24 5.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
268 274 3.048600 TGTGGATAAAGGGAGGGATGAG 58.951 50.000 0.00 0.00 0.00 2.90
498 504 1.107114 TTTTTGGAAGCTCCGTTGCA 58.893 45.000 0.00 0.00 40.17 4.08
521 527 5.355350 CAGGATTCAGACCTAACCATTCAAC 59.645 44.000 0.00 0.00 35.84 3.18
669 675 9.914131 AAATTAACAAATAAGACAGGAAAGAGC 57.086 29.630 0.00 0.00 0.00 4.09
1176 1188 4.776322 CCCGCTTGGATCACGGCA 62.776 66.667 9.45 0.00 45.58 5.69
1652 1683 5.241728 TGATGTGTATTCGAGTCATAGGAGG 59.758 44.000 0.00 0.00 0.00 4.30
1732 1763 1.410153 CATTGCCCCAAATGCCTCTAC 59.590 52.381 0.00 0.00 31.19 2.59
1875 1906 4.142249 CCAAAAGGAACTCGAGTTTTTGGT 60.142 41.667 37.15 23.16 42.59 3.67
2090 2126 7.293535 ACCTAGAATTAGAGTCTTATGGGCAAT 59.706 37.037 0.00 0.00 0.00 3.56
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
161 167 9.529325 GTTGCTACAACTATATGACACATCTAA 57.471 33.333 3.26 0.0 0.00 2.10
498 504 5.501156 GTTGAATGGTTAGGTCTGAATCCT 58.499 41.667 0.00 0.0 38.91 3.24
521 527 1.009389 GTCGTTCCCACTGCTTCTCG 61.009 60.000 0.00 0.0 0.00 4.04
669 675 3.705604 AGAATTTGCGGGCGAATATTTG 58.294 40.909 6.56 0.0 30.42 2.32
1176 1188 3.357203 TCGTCCTGCTTCTATCTGTCTT 58.643 45.455 0.00 0.0 0.00 3.01
1410 1424 5.979993 TGACTTCGTATGGGCATTTTACTA 58.020 37.500 0.00 0.0 0.00 1.82
1527 1543 9.384682 CAATTTGTTATTTCAATGCAAAAGGAC 57.615 29.630 0.00 0.0 32.58 3.85
1875 1906 0.392327 TCAATTCCTCGGCAATCGCA 60.392 50.000 0.00 0.0 41.24 5.10
2090 2126 7.620880 AGGTTAGTAAATCAGCAATAGTGTCA 58.379 34.615 0.00 0.0 0.00 3.58
2142 2178 6.837471 AGATACTACTCGAACTGTTCCTTT 57.163 37.500 14.48 1.9 0.00 3.11


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.