AutoCloner

Multiple sequence alignment - TraesCS2D01G232300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS2D01G232300	chr2D	100.000	6804	0	0	1	6804	205004310	205011113	0.000000e+00	12565.0
1	TraesCS2D01G232300	chr2B	94.392	3156	90	43	2898	6026	259032065	259035160	0.000000e+00	4767.0
2	TraesCS2D01G232300	chr2B	96.272	1395	39	7	1746	3134	259030671	259032058	0.000000e+00	2276.0
3	TraesCS2D01G232300	chr2B	94.472	995	18	11	782	1771	259029704	259030666	0.000000e+00	1498.0
4	TraesCS2D01G232300	chr2B	95.259	464	22	0	6341	6804	259035384	259035847	0.000000e+00	736.0
5	TraesCS2D01G232300	chr2B	96.825	189	4	2	599	785	458962478	458962290	1.420000e-81	315.0
6	TraesCS2D01G232300	chr2B	96.296	162	6	0	301	462	259029446	259029607	4.050000e-67	267.0
7	TraesCS2D01G232300	chr2B	94.928	138	7	0	6093	6230	259035183	259035320	4.130000e-52	217.0
8	TraesCS2D01G232300	chr2B	95.876	97	4	0	474	570	259029592	259029688	2.540000e-34	158.0
9	TraesCS2D01G232300	chr2B	94.872	78	4	0	1	78	259028575	259028652	9.270000e-24	122.0
10	TraesCS2D01G232300	chr2B	93.023	43	3	0	101	143	259028653	259028695	5.700000e-06	63.9
11	TraesCS2D01G232300	chr2A	94.660	2322	72	14	785	3084	278420129	278417838	0.000000e+00	3554.0
12	TraesCS2D01G232300	chr2A	96.696	2028	58	5	2898	4922	278417754	278415733	0.000000e+00	3365.0
13	TraesCS2D01G232300	chr2A	93.923	1086	27	9	4942	6019	278415676	278414622	0.000000e+00	1604.0
14	TraesCS2D01G232300	chr2A	93.548	496	27	2	6309	6804	278414430	278413940	0.000000e+00	734.0
15	TraesCS2D01G232300	chr2A	92.478	226	7	3	1	221	278445373	278445153	1.420000e-81	315.0
16	TraesCS2D01G232300	chr2A	97.015	134	4	0	236	369	278444560	278444427	6.870000e-55	226.0
17	TraesCS2D01G232300	chr2A	91.971	137	3	2	474	602	278420263	278420127	1.170000e-42	185.0
18	TraesCS2D01G232300	chr2A	96.364	55	2	0	408	462	278420302	278420248	2.610000e-14	91.6
19	TraesCS2D01G232300	chr4A	94.922	965	45	2	3489	4450	713262350	713263313	0.000000e+00	1507.0
20	TraesCS2D01G232300	chr4A	94.742	932	45	2	3489	4417	713252283	713253213	0.000000e+00	1447.0
21	TraesCS2D01G232300	chr4A	94.108	611	27	7	2931	3536	713251685	713252291	0.000000e+00	920.0
22	TraesCS2D01G232300	chr4A	94.108	611	27	7	2931	3536	713261752	713262358	0.000000e+00	920.0
23	TraesCS2D01G232300	chr4A	94.215	121	5	1	2705	2825	713251297	713251415	4.190000e-42	183.0
24	TraesCS2D01G232300	chr4A	94.215	121	5	1	2705	2825	713261364	713261482	4.190000e-42	183.0
25	TraesCS2D01G232300	chr5D	95.253	632	23	5	3489	4115	377304510	377305139	0.000000e+00	994.0
26	TraesCS2D01G232300	chr5D	94.272	611	27	7	2931	3536	377303871	377304478	0.000000e+00	928.0
27	TraesCS2D01G232300	chr5D	93.315	359	19	3	2705	3062	377303516	377303870	6.050000e-145	525.0
28	TraesCS2D01G232300	chr5D	97.368	190	3	2	598	785	159884720	159884531	8.510000e-84	322.0
29	TraesCS2D01G232300	chr5D	96.825	189	5	1	600	787	540003237	540003049	1.420000e-81	315.0
30	TraesCS2D01G232300	chr5D	90.805	87	4	3	6017	6099	166628151	166628065	5.580000e-21	113.0
31	TraesCS2D01G232300	chr4D	94.771	612	23	7	2931	3536	469151308	469151916	0.000000e+00	944.0
32	TraesCS2D01G232300	chr4D	94.599	611	25	6	2931	3536	409475576	409474969	0.000000e+00	939.0
33	TraesCS2D01G232300	chr4D	95.047	424	21	0	3489	3912	409474937	409474514	0.000000e+00	667.0
34	TraesCS2D01G232300	chr4D	93.632	424	19	3	3489	3912	469151908	469152323	1.610000e-175	627.0
35	TraesCS2D01G232300	chr4D	95.549	337	15	0	4114	4450	469152321	469152657	2.160000e-149	540.0
36	TraesCS2D01G232300	chr4D	94.955	337	17	0	4114	4450	409474516	409474180	4.670000e-146	529.0
37	TraesCS2D01G232300	chr4D	93.036	359	19	3	2705	3062	469150954	469151307	2.810000e-143	520.0
38	TraesCS2D01G232300	chr4D	92.758	359	21	3	2705	3062	409475931	409475577	1.310000e-141	514.0
39	TraesCS2D01G232300	chr4D	97.354	189	4	1	602	789	3288334	3288522	3.060000e-83	320.0
40	TraesCS2D01G232300	chr4D	96.296	189	6	1	600	787	315271798	315271986	6.630000e-80	309.0
41	TraesCS2D01G232300	chr4D	91.566	83	4	2	6020	6099	433367684	433367602	2.010000e-20	111.0
42	TraesCS2D01G232300	chr3D	94.435	611	26	6	2931	3536	323770309	323770916	0.000000e+00	933.0
43	TraesCS2D01G232300	chr3D	93.797	532	26	5	2931	3458	323778344	323778872	0.000000e+00	793.0
44	TraesCS2D01G232300	chr3D	94.575	424	23	0	3489	3912	323770908	323771331	0.000000e+00	656.0
45	TraesCS2D01G232300	chr3D	93.593	359	18	3	2705	3062	323769954	323770308	1.300000e-146	531.0
46	TraesCS2D01G232300	chr3D	93.593	359	18	3	2705	3062	323777989	323778343	1.300000e-146	531.0
47	TraesCS2D01G232300	chr3D	94.955	337	17	0	4114	4450	323771329	323771665	4.670000e-146	529.0
48	TraesCS2D01G232300	chr3D	97.895	190	2	2	599	787	42401732	42401920	1.830000e-85	327.0
49	TraesCS2D01G232300	chr3D	96.154	52	1	1	7	57	22265770	22265719	4.370000e-12	84.2
50	TraesCS2D01G232300	chrUn	96.825	189	5	1	600	787	51492864	51492676	1.420000e-81	315.0
51	TraesCS2D01G232300	chrUn	96.825	189	5	1	600	787	348959158	348959346	1.420000e-81	315.0
52	TraesCS2D01G232300	chrUn	95.349	43	0	2	5	45	103519472	103519514	4.400000e-07	67.6
53	TraesCS2D01G232300	chr7D	96.335	191	6	1	600	789	433896565	433896375	5.120000e-81	313.0
54	TraesCS2D01G232300	chr7A	82.967	182	28	3	6108	6288	490830585	490830406	1.960000e-35	161.0
55	TraesCS2D01G232300	chr3B	92.941	85	3	2	6020	6101	401410556	401410472	3.330000e-23	121.0
56	TraesCS2D01G232300	chr6D	92.857	84	3	1	6019	6099	433639208	433639291	1.200000e-22	119.0
57	TraesCS2D01G232300	chr1B	93.750	80	2	2	6020	6096	70337819	70337898	4.310000e-22	117.0
58	TraesCS2D01G232300	chr1B	93.506	77	3	1	6022	6096	174107772	174107848	5.580000e-21	113.0
59	TraesCS2D01G232300	chr7B	91.566	83	4	2	6020	6099	36733900	36733818	2.010000e-20	111.0
60	TraesCS2D01G232300	chr4B	90.588	85	5	1	6020	6101	329074192	329074108	7.210000e-20	110.0
61	TraesCS2D01G232300	chr5B	89.655	87	6	2	6016	6099	583164007	583163921	2.590000e-19	108.0

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS2D01G232300	chr2D	205004310	205011113	6803	False	12565.000000	12565	100.000000	1	6804	1	chr2D.!!$F1	6803
1	TraesCS2D01G232300	chr2B	259028575	259035847	7272	False	1122.766667	4767	95.043333	1	6804	9	chr2B.!!$F1	6803
2	TraesCS2D01G232300	chr2A	278413940	278420302	6362	True	1588.933333	3554	94.527000	408	6804	6	chr2A.!!$R1	6396
3	TraesCS2D01G232300	chr2A	278444427	278445373	946	True	270.500000	315	94.746500	1	369	2	chr2A.!!$R2	368
4	TraesCS2D01G232300	chr4A	713261364	713263313	1949	False	870.000000	1507	94.415000	2705	4450	3	chr4A.!!$F2	1745
5	TraesCS2D01G232300	chr4A	713251297	713253213	1916	False	850.000000	1447	94.355000	2705	4417	3	chr4A.!!$F1	1712
6	TraesCS2D01G232300	chr5D	377303516	377305139	1623	False	815.666667	994	94.280000	2705	4115	3	chr5D.!!$F1	1410
7	TraesCS2D01G232300	chr4D	409474180	409475931	1751	True	662.250000	939	94.339750	2705	4450	4	chr4D.!!$R2	1745
8	TraesCS2D01G232300	chr4D	469150954	469152657	1703	False	657.750000	944	94.247000	2705	4450	4	chr4D.!!$F3	1745
9	TraesCS2D01G232300	chr3D	323769954	323771665	1711	False	662.250000	933	94.389500	2705	4450	4	chr3D.!!$F2	1745
10	TraesCS2D01G232300	chr3D	323777989	323778872	883	False	662.000000	793	93.695000	2705	3458	2	chr3D.!!$F3	753

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
140	145	0.042431	AGAGGGAGGTGACATGAGCT	59.958	55.000	0.00	0.00	0.00	4.09	F
785	1671	0.105709	CTGGAACCAAACACCCCCTT	60.106	55.000	0.00	0.00	0.00	3.95	F
1109	2008	1.145156	CCGGAGCGAGAGAGAGAGA	59.855	63.158	0.00	0.00	0.00	3.10	F
2265	3213	1.009829	CAGTCCTCGCTGGCATTAAC	58.990	55.000	0.00	0.00	35.26	2.01	F
2681	3636	0.248843	GCTCACTCTCTGAAGGTGGG	59.751	60.000	8.93	7.28	34.86	4.61	F
2904	3892	0.813210	GCAGCCACTACAGCAGATCC	60.813	60.000	0.00	0.00	0.00	3.36	F
3711	5093	1.398762	CGTCTCGACATGCTGACACG	61.399	60.000	0.00	0.00	0.00	4.49	F
4945	6339	1.909302	TCTGGGAGGAAGGCTAACTTG	59.091	52.381	0.00	0.00	40.21	3.16	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
2098	3043	0.813210	GAGGCGGCCTCTGAATCTTG	60.813	60.000	35.90	0.00	46.41	3.02	R
2149	3094	0.176910	TCACTGTTGACTTGGCACGA	59.823	50.000	0.00	0.00	0.00	4.35	R
2664	3619	0.487325	TCCCCACCTTCAGAGAGTGA	59.513	55.000	3.93	0.00	33.21	3.41	R
3245	4507	2.295349	GCATCCTCCTGCATGGTTAATG	59.705	50.000	0.00	0.00	41.87	1.90	R
4573	5967	1.384191	AGCCTTGAATTTCCGGGCT	59.616	52.632	19.81	19.81	46.95	5.19	R
4812	6206	0.032217	CCTCTGAGCCTCTTCCCTCT	60.032	60.000	0.00	0.00	0.00	3.69	R
5241	6678	0.593008	GGATGCGTCGCGTGTATGTA	60.593	55.000	18.30	0.00	0.00	2.29	R
6191	7667	0.183971	TCACGTTCAAACCACCCCAT	59.816	50.000	0.00	0.00	0.00	4.00	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
97	102	2.700773	GCGGCCTTGTCCACCATTC	61.701	63.158	0.00	0.00	0.00	2.67
140	145	0.042431	AGAGGGAGGTGACATGAGCT	59.958	55.000	0.00	0.00	0.00	4.09
141	146	0.177604	GAGGGAGGTGACATGAGCTG	59.822	60.000	0.00	0.00	0.00	4.24
142	147	0.252421	AGGGAGGTGACATGAGCTGA	60.252	55.000	0.00	0.00	0.00	4.26
143	148	0.177604	GGGAGGTGACATGAGCTGAG	59.822	60.000	0.00	0.00	0.00	3.35
144	149	0.461693	GGAGGTGACATGAGCTGAGC	60.462	60.000	0.00	0.00	0.00	4.26
162	167	1.330655	GCTGACGGAGGGGAGATTCA	61.331	60.000	0.00	0.00	0.00	2.57
201	206	2.280389	CCCGATCCACTGGCATCG	60.280	66.667	16.76	16.76	41.34	3.84
210	215	2.821366	CTGGCATCGTGGGAGTGC	60.821	66.667	0.00	0.00	38.12	4.40
229	709	2.288457	TGCCTTAGAGCATATCAGCGTC	60.288	50.000	0.00	0.00	38.00	5.19
232	712	1.239347	TAGAGCATATCAGCGTCGCT	58.761	50.000	15.47	15.47	40.77	4.93
273	1029	0.779997	AACAAGGCCTGAAGGATGGT	59.220	50.000	5.69	0.00	37.39	3.55
320	1187	6.040166	CAGGGCAAATTTGTAAGCATAGAGAT	59.960	38.462	19.03	0.00	0.00	2.75
399	1266	9.487790	TTGTTGAATTTCCAAATAAGATCCAAC	57.512	29.630	0.00	0.00	0.00	3.77
417	1284	0.756903	ACACAGTAGGGCGAGTTGTT	59.243	50.000	0.00	0.00	0.00	2.83
460	1327	9.515226	TCCTGTTATTCTAAGCAAGTTTTACAT	57.485	29.630	0.00	0.00	0.00	2.29
464	1331	9.569167	GTTATTCTAAGCAAGTTTTACATTCCC	57.431	33.333	0.00	0.00	0.00	3.97
465	1332	6.584185	TTCTAAGCAAGTTTTACATTCCCC	57.416	37.500	0.00	0.00	0.00	4.81
466	1333	5.887754	TCTAAGCAAGTTTTACATTCCCCT	58.112	37.500	0.00	0.00	0.00	4.79
467	1334	7.023171	TCTAAGCAAGTTTTACATTCCCCTA	57.977	36.000	0.00	0.00	0.00	3.53
468	1335	7.463431	TCTAAGCAAGTTTTACATTCCCCTAA	58.537	34.615	0.00	0.00	0.00	2.69
469	1336	6.987403	AAGCAAGTTTTACATTCCCCTAAA	57.013	33.333	0.00	0.00	0.00	1.85
470	1337	6.987403	AGCAAGTTTTACATTCCCCTAAAA	57.013	33.333	0.00	0.00	0.00	1.52
471	1338	7.368198	AGCAAGTTTTACATTCCCCTAAAAA	57.632	32.000	0.00	0.00	0.00	1.94
568	1442	4.207891	AGCAGTACCACTAATCTGTTGG	57.792	45.455	0.00	0.00	0.00	3.77

Showing 1 to 25 of 291 entries

Previous1 2 3 4 5…12Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
57	58	0.674895	ATCCACGAACCTGCTCTTGC	60.675	55.000	0.00	0.00	40.20	4.01
97	102	0.734889	CCCCAGCGTTCTTGCTTATG	59.265	55.000	0.00	0.00	44.46	1.90
140	145	2.230189	ATCTCCCCTCCGTCAGCTCA	62.230	60.000	0.00	0.00	0.00	4.26
141	146	1.045911	AATCTCCCCTCCGTCAGCTC	61.046	60.000	0.00	0.00	0.00	4.09
142	147	1.002274	AATCTCCCCTCCGTCAGCT	59.998	57.895	0.00	0.00	0.00	4.24
143	148	1.330655	TGAATCTCCCCTCCGTCAGC	61.331	60.000	0.00	0.00	0.00	4.26
144	149	0.749649	CTGAATCTCCCCTCCGTCAG	59.250	60.000	0.00	0.00	0.00	3.51
162	167	2.106684	GTTGTCACCCTCCTCTTTTCCT	59.893	50.000	0.00	0.00	0.00	3.36
191	196	1.742880	CACTCCCACGATGCCAGTG	60.743	63.158	0.00	0.00	39.19	3.66
201	206	0.543749	ATGCTCTAAGGCACTCCCAC	59.456	55.000	0.00	0.00	45.36	4.61
210	215	2.590073	CGACGCTGATATGCTCTAAGG	58.410	52.381	0.00	0.00	0.00	2.69
229	709	2.202932	CCGTGATCCCCTTCAGCG	60.203	66.667	0.00	0.00	0.00	5.18
232	712	1.002403	TAGCCCGTGATCCCCTTCA	59.998	57.895	0.00	0.00	0.00	3.02
320	1187	7.773224	AGGATTATTTCACACAATATTCGGTGA	59.227	33.333	11.70	12.10	38.41	4.02
399	1266	2.607187	CTAACAACTCGCCCTACTGTG	58.393	52.381	0.00	0.00	0.00	3.66
417	1284	0.753262	GGATGCCTTCTTCTCGCCTA	59.247	55.000	0.00	0.00	0.00	3.93
470	1337	7.551035	TGATGCAATGTAAAACTTGCTTTTT	57.449	28.000	8.52	0.00	46.16	1.94
471	1338	7.441760	TCATGATGCAATGTAAAACTTGCTTTT	59.558	29.630	8.52	0.00	46.16	2.27
472	1339	6.930164	TCATGATGCAATGTAAAACTTGCTTT	59.070	30.769	8.52	0.00	46.16	3.51
473	1340	6.366877	GTCATGATGCAATGTAAAACTTGCTT	59.633	34.615	0.00	2.61	46.16	3.91
474	1341	5.865552	GTCATGATGCAATGTAAAACTTGCT	59.134	36.000	0.00	0.00	46.16	3.91
475	1342	5.062558	GGTCATGATGCAATGTAAAACTTGC	59.937	40.000	0.00	0.51	46.19	4.01
476	1343	5.286797	CGGTCATGATGCAATGTAAAACTTG	59.713	40.000	0.00	0.00	0.00	3.16
477	1344	5.048083	ACGGTCATGATGCAATGTAAAACTT	60.048	36.000	0.00	0.00	0.00	2.66
478	1345	4.458989	ACGGTCATGATGCAATGTAAAACT	59.541	37.500	0.00	0.00	0.00	2.66

Showing 1 to 25 of 318 entries

Previous1 2 3 4 5…13Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.